25 resultados para Human oral keratinocytes
em Scielo Saúde Pública - SP
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Fusobacterium nucleatum is a strict anaerobe and is indigenous of the human oral cavity. This organism is commonly recovered from different monomicrobial and mixed infections in humans and animals. In this study, the plasmid profile, the plasmid stability and the penicillin-resistance association in oral F. nucleatum isolated from periodontal patients, healthy subjects and Cebus apella monkeys were evaluated. Forty-five F. nucleatum strains from patients, 38 from healthy subjects and seven from C. apella were identified and analyzed. Plasmid extraction was performed in all the isolated strains. These elements were found in 26.7% strains from patients and one strain from C. apella. Strains from healthy subjects did not show any plasmid. Most of strains showed two plasmid bands ranging from 4 to 16 Kb, but digestions with endonucleases showed that they belonged to a single plasmid. The plasmid profile was similar and stable in human and monkey strains. Also, plasmids were classified into three groups according to size. Two strains were positive to beta-lactamase production and no plasmid DNA-hybridization with a beta-lactamase gene probe was observed, suggesting a chromosomal resistance.
Resumo:
In view of anticancer activity of 7 β-acetoxywithanolide D (2) and 7β-16α-diacetoxywithonide D (3), isolated from the leaves of Acnistus arborescens (Solanaceae), five withanolide derivatives were obtained and their structures were determined by NMR, MS and IV data analysis. The in vitro anticancer activity of these derivatives was evaluated in a panel of cancer cell lines: human breast (BC-1), human lung (Lu1), human colon (Col2) and human oral epidermoid carcinoma (KB). Compounds 2a (acetylation of 2), 3b (oxidation of 3) and 2c (hydrogenation of 2) exhibited the highest anticancer activity against human lung cancer cells, with ED50 values of 0.19, 0.25 and 0.63 μg/mL, respectively.
Resumo:
Primary cultures of human keratinocytes were challenged with increasing doses from 10 ng/mL to 2 mg/mL of Loxosceles gaucho venom, responsible for dermonecrotic lesion in humans. TNF-a was investigated by bioassay and ELISA in the supernatant of the cultures challenged with 100 ng/mL, 500 ng/mL, 1 and 2 mg/mL of venom. TNF-a was detected by bioassay in the supernatant of cultures challenged with 100 ng/mL, after 6 h. The cytokine was detected by ELISA in the supernatant of the cells challenged with doses of l mg/mL, after 6 and 12 h. The results point out the capacity of this venom to activate the keratinocytes in primary cultures to produce TNF-a. The production of cytokines could contribute to the local inflammatory process in patients bitten by Loxosceles sp.
Resumo:
Thirty-eight patients with scabies (21 males and 17 females) received oral ivermectin in two doses of 200 mg/kg at 7 days interval. Excellent results were achieved in 29 cases (76.34%), improvement in 6 (15.78%) and poor responses in 3 (7.88%). Tolerance was satisfactory-excellent in 32 patients (84.2%). The effectiveness and safety of the drug described in previous studies are confirmed by the present results.
Resumo:
One of the main opportunistic fungal infections amongst immunocompromised individuals is oral candidosis, which has been found in up to 90% of human immunodeficiency virus (HIV)-infected patients. This study employed yeasts isolated from the saliva and oral cavities of 114 HIV-infected patients living in Campinas, São Paulo. Of the isolates, 57.8% were identified as Candida albicans and 42.1% as non-C. albicans. The latter isolates were subsequently identified as C. krusei (7.5%), C. lusitaniae (5.2%), C. tropicalis (4.6%), C. parapsilosis (4.6%), C. glabrata (2.8%), C. kefyr (1.7%), C. guilliermondii (1.7%), C. intermedia (1.1%), C. norvegensis (0.5%), and Rhodotorula rubra (1.7%). Susceptibility of the isolates to amphotericin B, fluconazole, miconazole, and itraconazole was also determined by a microdilution method adopted by the National Committee for Clinical Laboratory Standards. The isolates demonstrated various susceptibilities to the antifungal agents. In particular 29 C. albicans and 13 non-C. albicans isolates showed low susceptibility to FLCZ (> 64 µg/ml). This study revealed huge diversity of Candida species, in particular the increasing emergence of non-C. albicans associated with the oral flora of HIV-infected patients.
Resumo:
The purpose of this study was to compare the histopathological analysis with polymerase chain reaction (PCR) methods to predict the presence of human papillomavirus (HPV) infection in oral squamous cell carcinoma biopsies. Eighty-three paraffin-embedded tissue specimens from patients with oropharynx and mouth floor squamous cell carcinoma were submitted to histopathological analysis under light microscopy, specifically for the determination of the presence of koilocytes. Subsequently, DNA was purified from the same paraffin-embedded specimens and submitted to PCR. Fisher's exact test showed no statistically significant correlation between the two methods. The results suggest that the presence of koilocytes is unreliable for the detection of HPV presence in oral and oropharynx squamous cell carcinoma.
Resumo:
In a large Phase III trial conducted in 10 Latin American countries, the safety and efficacy of the live attenuated monovalent rotavirus vaccine RIX4414 was evaluated in 15,183 healthy infants followed up during the first two years of life. Belém was the only site in Brazil included in this multicentre trial. The study in Belém included a subset of 653 infants who were followed up until 24 months of age for protection against severe rotavirus gastroenteritis. These subjects were randomly assigned in a 1:1 ratio to receive two doses of vaccine (n = 328) or two doses of placebo (n = 325) at approximately two and four months of age. Of the 653 enrolled infants, 23 dropped out during the study period. For the combined two-year period, the efficacy of RIX4414 was 72.3% [95% confidence interval (CI) 37.5-89.1%] against severe rotavirus-related gastroenteritis, reaching a protection rate of 81.8% (95% CI 36.4-96.6%) against circulating wild-type G9 rotavirus strains. It is concluded that two doses of RIX4414 are highly efficacious against severe rotavirus gastroenteritis in Belém during the first two years of life and provide high protection against the worldwide emergence and spread of G9P[8] strains.
Resumo:
OBJECTIVE:To evaluate public health dentistry practices of two different family health models. METHODS: Qualitative study conducted with data obtained from focus groups consisting of 58 dentists working in the Family Health Strategy for at least three years between August-October, 2006. The Paideia Family Health Approach was used in the city of Campinas and the Oral Health Initiative as part of the Family Health Strategy was implemented in the city of Curitiba, Southeastern and Southern Brazil, respectively. Data was analyzed using the hermeneutic-dialectic method. Analysis indicators were employed to indicate backwardness, stagnation or progress in oral health practices effective from the implementation of the strategies referred. The indicators used were: work process; interdisciplinary approach; territorialization; capacity building of human resources; health promotion practices; and responsiveness to users' demands. RESULTS: There was progress in user access to services, humanization of health care, patient welcoming and patient-provider relationship. The results related to health promotion practices, territorialization, interdisciplinary approach and resource capacity building indicated a need for technical and operational enhancements in both cities. CONCLUSIONS: Both models have brought about important advances in terms of increased access to services and humanization of health care. Universal access to oral health at all levels of complexity was not achieved in both cities studied. Local health managers and oral health program coordinators must bring more weight to bear in the arena that defines public policy priorities.
Resumo:
In October, 1986, 7 to 22 days after a meeting at a farm in Paraíba state, 26 individuals presented with a febrile illness associated with bilateral eyelid and lower limb edema, mild hepatosplenomegaly, lymphadenopathy and, occasionally a skin rash. A 11-year-old boy exhibited atrial premature complexes and a 74-year-old patient developed acute heart failure. In two patients hospitalized in São Paulo city, acute Chagas' disease was diagnosed by the demonstration of circulating Trypanosoma cruzi. At autopsy in a fatal case, acute Chagas' cardiomyopathy was demonstrated. Xenodiagnosis were positive in 9 out of 14 tested patients. A specific IgG immune response was found in all patients and specific IgM antibodies were identified in 20 out of 22 tested patients. A epidemiological survey showed the existence of Triatoma brasiliensis in the outbuildings of this farm, but none in the house where most of the guests stayed. A high rate of infection with Trypanosoma cruzi was found in opossums. These observations together with those related to the food consumed by the patients, lead the authors to suggest that the human infections resulted from oral contamination probably originating from naturally infected marsupials in the area or crushed infected bugs.
Resumo:
Oropharyngeal candidiasis is the most common opportunistic fungal infection in individuals infected with human immunodeficiency virus. CD4+ lymphocytes count and the quantification of viral RNA in blood plasma have been found to be the main markers of HIV disease progression. The present study was conducted to evaluate Candida sp. diversity in the oral cavity of HIV-infected patients and to determine whether there was association of CD4+ cell count and viral load with asymptomatic oral Candida carriage. Out of 99 HIV-positive patients studied, 62 (62.6%) had positive culture for Candida (oral carriage) and 37 patients (37.4%) had Candida negative culture (no oral carriage). The etiologic agents most common were C. albicans and C. tropicalis. The range of CD4+ was 6-2305 cells/mm³ in colonized patients and 3-839 cells/mm³ for non-colonized patients, while the viral load was 60-90016 copies/mL for colonized patients and 75-110488 copies/mL for non colonized patients. The viral load was undetectable in 15 colonized patients and in 12 non colonized patients. Our results showed that there was no significant difference of the variables CD4+ cell count and viral load between oral candida carriage and no oral candida carriage patients.
Resumo:
INTRODUCTION: Some viruses of the Herpesviridae family are frequently the etiologic agents of oral lesions associated with HIV. The aim of this study was to identify the presence of herpes simplex virus types 1 and 2 (HSV-1, HSV-2), Varicella Zoster virus (VZV), Epstein-Barr virus (EBV), human cytomegalovirus (HCMV), human herpesvirus type 6, type 7 and type 8 (HHV-6, HHV-7 and HHV-8) in the oral cavity of HIV-infected children/adolescents and verify the association between viral subtypes and clinical factors. METHODS: The cells of oral mucosa were collected from 50 HIV infected children/adolescents, 3-13 years old (mean age 8.66). The majority (66%) of selected were girls, and they were all outpatients at the pediatric AIDS clinic of a public hospital in Rio de Janeiro. Nested-PCR was used to identify the viral types. RESULTS: Absence of immunosuppression was observed in 66% of the children. Highly active antiretroviral therapy (HAART) was used by 72.1% of selected and moderate viral load was observed in 56% of the children/adolescents. Viral types were found in 86% of the children and the subtypes were: HSV-1 (4%), HSV-2 (2%), VZV (4%), EBV (0%), HCMV (24%), HHV6 (18%), HHV-7 (68%), HHV8 (0%). CONCLUSIONS: The use of HAART has helped to reduce oral lesions, especially with herpes virus infections. The health professionals who work with these patients should be aware of such lesions because of their predictive value and the herpes virus can be found circulating in the oral cavity without causing lesions.
Resumo:
INTRODUCTION: This study aimed to estimate the prevalence of the most frequent oral and systemic manifestations in human immunodeficiency virus-1 (HIV-1)-positive patients. METHODS: The study was conducted on 300 HIV-1 patients attending the Reference Unit Specialized in Special Infectious Parasitic Diseases in Belém, Pará, Brazil. RESULTS: The most prevalent oral conditions were caries (32.6%), candidiasis (32%), and periodontal disease (17%). Among the systemic manifestations, hepatitis (29.2%), gastritis (16%), arterial hypertension (14.7%), and tuberculosis (12%) were the most commonly observed. CONCLUSIONS: We here reported on the most prevalent oral and systemic conditions in HIV-1-positive patients. The healthcare professional's knowledge of the various manifestations among these patients is fundamental to ensure prompt and accurate diagnosis and treatment, and for improving the quality of life of these patients.
Resumo:
Human babesiosis in Europe came to medical attention in 1957 and until now 19 cases have been reported, most of them due to Babesia divergens. The onset of the disease is characterized by hemoglobinuria, high fever and renal failure ensue rapidly. The patients were generally asplenic and resident in a rural area. Intraerythrocytic pleomorphic parasites (1-3 µm) observed in stained thin blood smears are essential for Genus diagnosis. Parasitemia varyed from 5 to 80% of red blood cells. Massive blood exchange transfusion (2-3 blood volumes) followed by intravenous clindamycine (3-4 times daily) and oral quinine (600 mg base, 3 times daily) were successfully used in the treatment of three recent cases. Splenectomised individuals should be aware for prevention.
Resumo:
Diagnostic and therapeutic aspects of human infection with Leishmania (Viannia) braziliensis found in the littoral forest of the state of Bahia are reviewed. There is pressing need for alternative cheap oral drug therapy.