Human mixed infections of Leishmania spp. and Leishmania-Trypanosoma cruzi in a sub Andean Bolivian area: identification by polymerase chain reaction/hybridization and isoenzyme

Parasites belonging to Leishmania braziliensis, Leishmania donovani, Leishmania mexicana complexes and Trypanosoma cruzi (clones 20 and 39) were searched in blood, lesions and strains collected from 28 patients with active cutaneous leishmaniasis and one patient with visceral leishmaniasis. PCR-hybridization with specific probes of Leishmania complexes (L. braziliensis, L. donovani and L. mexicana) and T. cruzi clones was applied to the different DNA samples. Over 29 patients, 8 (27.6%) presented a mixed infection Leishmania complex species, 17 (58.6%) a mixed infection Leishmania-T. cruzi, and 4 (13.8%) a multi Leishmania-T. cruzi infection. Several patients were infected by the two Bolivian major clones 20 and 39 of T. cruzi (44.8%). The L. braziliensis complex was more frequently detected in lesions than in blood and a reverse result was observed for L. mexicana complex. The polymerase chain reaction-hybridization design offers new arguments supporting the idea of an underestimated rate of visceral leishmanisis in Bolivia. Parasites were isolated by culture from the blood of two patients and lesions of 10 patients. The UPGMA (unweighted pair-group method with arithmetic averages) dendrogram computed from Jaccard's distances obtained from 11 isoenzyme loci data confirmed the presence of the three Leishmania complexes and undoubtedly identified human infections by L. (V.) braziliensis, L. (L.) chagasi and L. (L.) mexicana species. Additional evidence of parasite mixtures was visualized through mixed isoenzyme profiles, L. (V.) braziliensis-L. (L.) mexicana and Leishmania spp.-T. cruzi.The epidemiological profile in the studied area appeared more complex than currently known. This is the first report of parasitological evidence of Bolivian patients with trypanosomatidae multi infections and consequences on the diseases' control and patient treatments are discussed.

Human identification and analysis of DNA in bones

The introduction of molecular biology techniques, especially of DNA analysis, for human identification is a recent advance in legal medicine. Substantial effort has continuously been made in an attempt to identify cadavers and human remains after wars, socio-political problems and mass disasters. In addition, because of the social dynamics of large cities, there are always cases of missing people, as well as unidentified cadavers and human remains that are found. In the last few years, there has also been an increase in requests for exhumation of human remains in order to determine genetic relationships in civil suits and court action. The authors provide an extensive review of the literature regarding the use of this new methodology for human identification of ancient or recent bones.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Recent occurence of human infection by Rocio arbovirus in Ribeira Valley, Brazil

The presence of IgM antibodies to Rocio in sera of two children from rural area of Ribeira Valley, Brazil, was detected by MAC-ELISA. This new arbovirus of the Flaviviridae family was responsible for an extensive encephalitis epidemic that occurred in the region in 1975-1977. Since 1980 no human disease caused by this virus has been diagnosed. An improvement on surveillance of Rocio infections and on the researches for virus identification in suspected vectors and reservoirs is necessary.

Hb Köln [a2b298(FG5) val-met] identified by DNA analysis in a Brazilian family

Hb Köln was identified by DNA analysis in a Brazilian patient. A four-year old Brazilian female, with jaundice since birth, presented an abnormal band, between A2 and S, in hemoglobin electrophoresis on a cellulose acetate membrane, and a band with electrophoretic migration similar to Hb C on agar gel. Thermic instability and isopropanol precipitation tests were positive. Heinz bodies were observed in the patient’s peripheral blood. Sequencing of the three exons of the b globin gene detected a transition from G to A in the first position of codon 98. This alteration does not create or abolish any known restriction site. In this case, confirmation of the mutation was accomplished by allele-specific oligonucleotide hybridization, which is a simple and fast identification method when the clinical data and hematological and electrophoretic patterns are suggestive of Hb Köln.

The prima donna of epigenetics: the regulation of gene expression by DNA methylation

This review focuses on the mechanisms of DNA methylation, DNA methylation pattern formation and their involvement in gene regulation. Association of DNA methylation with imprinting, embryonic development and human diseases is discussed. Furthermore, besides considering changes in DNA methylation as mechanisms of disease, the role of epigenetics in general and DNA methylation in particular in transgenerational carcinogenesis, in memory formation and behavior establishment are brought about as mechanisms based on the cellular memory of gene expression patterns.

Human parasitism by Phagicola sp (Trematoda, Heterophyidae) in Cananéia, São Paulo State, Brazil

We report one case of parasitism by Phagicola sp. (Trematoda, Heterophyidae) in a 31 years-old woman who, in 1987, travelled and stayed several months in the municipality of Cananéia (SP), where she ingested, in various occasions, raw mullet (Mugil sp.). The patient refered mild intestinal pain and laboratory examinations showed eggs of Phagicola sp. in the stools and a slight increase in eosinophil blood levels (8%). After treatment with praziquantel (75 mg/kg per day for three days) all the symptoms and signs disappeared. This is, certainly, the first record of human infection by Phagicola sp. in Brazil and, perhaps, in countries other than the U.S.A. where unclear references to a few human cases were reported in the South-eastern region.

First case of human infection by Trichophyton vanbreuseghemii in Brazil

This paper reports the first case of human infection caused by Ttrichophyton vanbreuseghemii in Brazil.

Diagnosis of human toxoplasmosis by a dot enzyme-linked immunosorbent assay

A Dot enzyme-linked immunosorbent assay (Dot-ELISA) was standardized and evaluated for the serodiagnosis of human toxoplasmosis. Out of 538 serum samples tested by the immunofluorescence test for toxoplasmosis (IFAT-IgG) as reference test, 183 (34%) were positive at cut off 1:16 and 192 (36%) were positive for Dot-ELISA-IgG at cut-off 1:256. For Dot-ELISA, co-positivity was 0.94, co-negativity 0.94 and concordance 0.88 in relation to IFAT-IgG. These results suggest the usefulness of Dot-ELISA (cut-off titer of 1:256) for the serodiagnosis of human toxoplasmosis. The main advantage of this technique is simplicity, positive test can be visually identified (colored precipitate). It does not require a special equipment and it can be used as a qualitative test to screen large numbers of samples or as a quantitative assay to determine end-point titration of individual sera.

Etiological drug treatment of human infection by Trypanosoma cruzi

Forty-nine American Trypanosomiasis (Chagas' disease) patients, with xenodiagnosis proven parasitemia were treated by the authors. Forty-one of these patients were given benznidazole, at dosages ranging from 5mg/kg/day to 8mg/kg/day, during a pre-established period of 60 days. In this group, 17 patients had an undetermined form of the disease, whereas 22 had cardiologic disease and 4 had digestive disease (two patients had a mixed form of the disease). Side effects were frequent, and led to the discontinuation of treatment in 17 patients. The follow-up period ranged from 1 to 20 years (mean follow-up period of 6 yrs. 7 mo). 26 (63.4%) of the patients became parasitemia-negative. The other eight patients were treated with nifurtimox, during 120 days, following a variable dose regime of 5mg/kg/day (initial dose) to 17 mg/kg/day (final dose). Six of them had severe side effects, and only one patient remained parasitemia-negative throughout the observation period (ranging from 1 to 18 years). Benznidazole proved to be better tolerated and more effective in the management of parasitemia when compared to nifurtimox, although more effective and less toxic drugs are still desirable.

Cross-reactivity of antibodies in human infections by the kinetoplastid protozoa Trypanosoma cruzi, Leishmania chagasi and Leishmania (Viannia) braziliensis

We have detected antibodies, in the sera of Chagas disease, Kala-azar and Mucocutaneous leishmaniasis patients, that bind multiple antigens shared between the three causative agents. The Chagas disease sera showed 98 to 100% positive results by ELISA when the Leishmania braziliensis and Leishmania chagasi antigens were used, respectively. The Kala-azar sera showed 100% positive results with Trypanosoma cruzi or L. braziliensis antigens by immunofluorescence assays. The antibodies in the sera of Mucocutaneous leishmaniasis patients showed 100% positive results by ELISA assays with T. cruzi or L. chagasi antigens. Furthermore, the direct agglutination of L. chagasi promastigotes showed that 95% of Kala-azar and 35% of Mucocutaneous leishmaniasis sera agglutinated the parasite in dilutions above 1:512. In contrast, 15% of Chagas sera agglutinated the parasite in dilutions 1:16 and below. Western blot analysis showed that the Chagas sera that formed at least 24 bands with the T. cruzi also formed 13 bands with the L. chagasi and 17 bands with the L. braziliensis. The Kala-azar sera that recognized at least 29 bands with the homologous antigen also formed 14 bands with the T. cruzi and 10 bands with the L. braziliensis antigens. Finally, the Mucocutaneous leishmaniasis sera that formed at least 17 bands with the homologous antigen also formed 10 bands with the T. cruzi and four bands with the L. chagasi antigens. These results indicate the presence of common antigenic determinants in several protozoal proteins and, therefore, explain the serologic cross-reactions reported here.

Human bertiellosis in Goiás, Brazil: a case report on human infection by Bertiella sp. (Cestoda: Anoplocephalidae)

The authors report on a new case of human Bertiellosis in a 2-year old female patient who was born in Goiânia-Goiás (Brazil) and has had history of permanent dwelling in an area frequently visited by simians in Mato Grosso (Brazil). At the time of diagnosis the patient showed inappetence, abdominal pain, and loss of weight. Eggs and proglottids were found in her stool and were identified as Bertiella sp. The objective of this report is to register the third case of human Bertiellosis in Brazil, characterizing one more case of helminthic zoonosis.

Description of an injury in a human caused by a false tocandira (Dinoponera gigantea, Perty, 1833) with a revision on folkloric, pharmacological and clinical aspects of the giant ants of the genera Paraponera and Dinoponera (sub-family Ponerinae)

The authors observed an injury caused by the sting of a false tocandira ant in the hand of an amateur fisherman and they describe the clinical findings and the evolution of the envenoming, which presented an acute and violent pain, cold sweating, nausea, a vomiting episode, malaise, tachycardia and left axillary's lymphadenopathy. About three hours after the accident, still feeling intense pain in the place of the sting, he presented an episode of great amount of blood in the feces with no history of digestive, hematological or vascular problems. The intense pain decreased after eight hours, but the place stayed moderately painful for about 24 hours. In that moment, he presented small grade of local edema and erythema. The authors still present the folkloric, pharmacological and clinical aspects related to the tocandiras stings, a very interesting family of ants, which presents the largest and more venomous ants of the world.

Human infection by Angiostrongylus costaricensis in Venezuela: first report of a confirmed case

A proven case of human infection caused by Angiostrongylus costaricensis is reported for the first time in Venezuela. The patient was a 57-year-old female surgically operated because of signs of peritonitis with a palpable mass at the lower right quadrant of the abdomen. WBC count reported 16,600 cells/mm³, with 46% eosinophils. The tumoral aspect of ileocolic area and peritoneal lymph nodes prompted the resection of a large area of the terminal ileum, cecum, part of the ascending colon and a small part of the jejunum, where a small lesion was found. The pathology showed thickened areas of the intestinal wall with areas of hemorrhage and a perforation of the cecum. Histology showed intense eosinophil infiltration of the whole intestinal wall, granulomas with giant cells and eosinophils. Some of the granuloma surrounded round or oval eggs with content characterized by a large empty area, cells or embryo in the center, and sometimes nematode larvae. A cross section of an adult nematode worm was observed inside a branch of mesenteric artery. The intestinal affected area, the characteristics of the lesions, the presence of eggs in the submucosa with nematode larvae inside, and the observation of a nematode inside a mesenteric artery, makes sufficient criteria for the diagnosis of an infection by Angiostrongylus costaricensis.

FIRST CASE OF HUMAN INFECTION BY Bertiella studeri (Blanchard, 1891) Stunkard,1940 (Cestoda; Anoplocephalidae) IN BRAZIL

SUMMARY Cestodes of the Bertiella genus are parasites of non-human primates found in Africa, Asia, Oceania and the Americas. Species Bertiella studeri and Bertiella mucronatacould, accidentally, infect human beings. The infection occurs from ingestion of mites from the Oribatida order containing cysticercoid larvae of the parasite. The objective of this report is to register the first case of human infection by Bertiella studeri in Brazil. Proglottids of the parasite, found in the stool sample of a two-and-a-half-year-old child, were fixed, stained and microscopically observed to evaluate its morphological characteristics. Eggs obtained from the proglottids were also studied. The gravid proglottids examined matched the description of the genus Bertiella. The eggs presented a round shape, with the average diameter of 43.7 µm, clearly showing the typical pyriform apparatus of B. studeri. The authors concluded that the child was infected with Bertiella studeri,based on Stunkard's (1940) description of the species. This is the fifth case of human Bertiellosis described in Brazil through morphometric analysis of the parasite, the third in Minas Gerais State and the first diagnosed case of Bertiella studeriin Brazil.