10 resultados para Human Epidermal Keratinocytes

em Scielo Saúde Pública - SP


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

PURPOSE:To compare the prognostic and predictive features between in situ and invasive components of ductal breast carcinomas. METHODS:We selected 146 consecutive breast samples with ductal carcinoma in situ (DCIS) associated with adjacent invasive breast carcinoma (IBC). We evaluated nuclear grade and immunohistochemical expression of estrogen receptor (ER), progesterone receptor (PR), human epidermal growth factor receptor 2 (HER2), cytokeratin 5/6 (CK5/6), and epidermal growth factor receptor (EGFR) in both components, in situ and invasive, and the Ki-67 percentage of cells in the invasive part. The DCIS and IBC were classified in molecular surrogate types determined by the immunohistochemical profile as luminal (RE/PR-positive/ HER2-negative), triple-positive (RE/RP/HER2-positive), HER2-enriched (ER/PR-negative/HER2-positive), and triple-negative (RE/RP/HER2-negative). Discrimination between luminal A and luminal B was not performed due to statistical purposes. Correlations between the categories in the two groups were made using the Spearman correlation method. RESULTS:There was a significant correlation between nuclear grade (p<0.0001), expression of RE/RP (p<0.0001), overexpression of HER2 (p<0.0001), expression of EGFR (p<0.0001), and molecular profile (p<0.0001) between components in situ and IBC. CK 5/6 showed different distribution in DCIS and IBC, presenting a significant association with the triple-negative phenotype in IBC, but a negative association among DCIS. CONCLUSIONS: Our results suggest that classical prognostic and predictive features of IBC are already determined in the preinvasive stage of the disease. However the role of CK5/6 in invasive carcinoma may be different from the precursor lesions.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The objective of the present investigation was to study the expression of c-erbB-2 and MIB-1 and try to associate them with morphological features of the cell such as nuclear pleomorphism, mitotic count and histological grade in a series of 70 canine mammary gland tumors, 22 of them benign and 48 malignant. Tumors were collected at the Veterinary Hospital of UFMG (Brazil) and the Veterinary Faculty of Porto University (Portugal). c-erbB-2 expression was determined according to the guidelines provided by the manufacturer of the HercepTest system and nuclear pleomorphism, mitotic count and histological grade according the Elston and Ellis grading system. The HercepTest is the FDA-approved in vitro diagnostic test marketed by Dako. It is a semi-quantitative immunohistochemical assay used to determine overexpression of HER2 protein (human epidermal growth factor receptor) in breast cancer tissue. MIB-1 expression was also evaluated in 28 malignant tumors. Seventeen (35.4%) of the malignant tumors were positive for c-erbB-2 expression, which was positively associated with nuclear pleomorphism (P < 0.0001), histological grade (P = 0.0017) and mitotic count (P < 0.05). Nuclear pleomorphism also showed a positive association with MIB-1 index (P < 0.0001). These results suggest that some of the biological and morphological characteristics of the tumor are associated in canine mammary gland tumors, as also reported for human breast cancer. It was also possible to show that the immunoexpression of c-erbB-2 can be a factor in mammary carcinogenesis. This fact opens the possibility of using anti-c-erbB-2 antibodies in the treatment of canine mammary tumors.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Human epidermal growth factor receptor 2 (HER2) has been evaluated in breast cancer patients to identify those most likely to benefit from herceptin-targeted therapy. HER2 amplification, detected in 20-30% of invasive breast tumors, is associated with reduced survival and metastasis. The most frequently used technique for evaluating HER2 protein status as a routine procedure is immunohistochemistry (IHC). HER2 copy number alterations have also been evaluated by fluorescence in situ hybridization (FISH) in moderate immunoexpression (IHC 2+) cases. An alternative procedure to evaluate gene amplification is chromogenic in situhybridization (CISH), which has some advantages over FISH, including the correlation between HER2 status and morphological features. Other methodologies have also been used, such as silver-enhanced in situ hybridization (SISH) and quantitative real-time RT-PCR, to determine the number of HER2 gene copies and expression, respectively. Here we will present a short and comprehensive review of the current advances concerning HER2 evaluation in human breast cancer.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Primary cultures of human keratinocytes were challenged with increasing doses from 10 ng/mL to 2 mg/mL of Loxosceles gaucho venom, responsible for dermonecrotic lesion in humans. TNF-a was investigated by bioassay and ELISA in the supernatant of the cultures challenged with 100 ng/mL, 500 ng/mL, 1 and 2 mg/mL of venom. TNF-a was detected by bioassay in the supernatant of cultures challenged with 100 ng/mL, after 6 h. The cytokine was detected by ELISA in the supernatant of the cells challenged with doses of l mg/mL, after 6 and 12 h. The results point out the capacity of this venom to activate the keratinocytes in primary cultures to produce TNF-a. The production of cytokines could contribute to the local inflammatory process in patients bitten by Loxosceles sp.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

There are few studies on the role of innate immune response in dermatophytosis. An investigation was conducted to define the involvement of Toll-Like Receptors (TLRs) 2 and 4 in localized (LD) and disseminated (DD) dermatophytosis due to T. rubrum. Fifteen newly diagnosed patients, eight patients with LD and seven with DD, defined by involvement of at least three body segments were used in this study. Controls comprised twenty skin samples from healthy individuals undergoing plastic surgery. TLR2 and TLR4 were quantified in skin lesions by immunohistochemistry. A reduced expression of TLR4 in the lower and upper epidermis of both LD and DD patients was found compared to controls; TLR2 expression was preserved in the upper and lower epidermis of all three groups. As TLR4 signaling induces the production of inflammatory cytokines and neutrophils recruitment, its reduced expression likely contributed to the lack of resolution of the infection and the consequent chronic nature of the dermatophytosis. As TLR2 expression acts to limit the inflammatory process and preserves the epidermal structure, its preserved expression may also contribute to the persistent infection and limited inflammation that are characteristic of dermatophytic infections.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Epidermal changes from 32 cutaneous and 3 mucosal American leishmaniasis (ACL) active lesions were studied for HLA-DR, -DP expression, Lanerhans cells and lymphocyte infiltration. In addition to a DR and DQ positivity at the surface of the cells of the inflammatory infiltrate, a strong reaction for DR antigens was detected on keratinocytes. Hyperplasia of Langerhans cells was present in al cutaneous lesions and epidermis was infiltrated by T lymphocytes. When healed lesions of 14 of these subjects were re-biopsied 1 to 12 months after the end of pentavalent antimonial therapy, MHC class antigens could no longer be seen on keratinocytes. Our data represrn evidence for hhe reversibility of the abnormal HLA-DR expression by keratinocytes in ACL after Glucantime therapy or spontaneous scar formation, demonstrating that this expresion is restricted to the period of active lesions. The present findings can be regarded as an indirect evidence that keratinocytes may be involved in the immunopathology of ACL.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Human subjects with active vulgar vitiligo do not respond well to autologous dermo-epidermal minigrafting. Eighteen subjects were treated with the a-melanocyte-stimulating hormone (a-MSH) synthetic analogue &#091;Nle4, D-Phe7&#093;-a-MSH. The hormone (50 µl, 0.4 mM) was applied topically to 30-cm2 lesions in which 29-48 minigrafts had been made. The hormone did not improve the success of the minigrafting and no differences were observed in local or distant repigmentation in treated subjects as compared to the placebo group. Aliquots of 24-h urine concentrated by lyophilization irreversibly darkened toad skins, demonstrating the presence of the analogue. This is the first report of the transdermal delivery of a topically applied melanotropin in living human subjects.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

DEAD-box proteins comprise a family of ATP-dependent RNA helicases involved in several aspects of RNA metabolism. Here we report the characterization of the human DEAD-box RNA helicase DDX26. The gene is composed of 14 exons distributed over an extension of 8,123 bp of genomic sequence and encodes a transcript of 1.8 kb that is expressed in all tissues evaluated. The predicted amino acid sequence shows a high similarity to a yeast DEAD-box RNA helicase (Dbp9b) involved in ribosome biogenesis. The new helicase maps to 7p12, a region of frequent chromosome amplifications in glioblastomas involving the epidermal growth factor receptor (EGFR) gene. Nevertheless, co-amplification of DDX26 with EGFR was not detected in nine tumors analyzed.