47 resultados para HUMAN SKIN SUBSTITUTE

em Scielo Saúde Pública - SP


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Chagas disease is a major public health issue and is mainly spread by Triatominae insects (Hemiptera: Reduviidae). Rhodnius prolixus is the main vector species in Northern South America. Host-seeking behaviour in R. prolixus is mediated by different compounds that are produced by and emanate from the host or microbiota on the host's skin. We tested the behavioural responses of sylvatic first filial generation (F1) and colony insects to extracts of human skin with a dual choice olfactometer. In addition, we compared the antennal phenotypes in both populations. No statistical differences were found between the two populations at the behavioural level. Both showed a preference for face and feet extracts and this effect was abolished for face extracts after treatment with an antibacterial gel. The observation of the antennal phenotype showed that there were differences between both groups in the total length, total surface area and number and density of bristles. However, the number and density of chemoreceptive sensilla (basiconic and thin and thick-walled trichoids) and the total density of sensilla did not show statistically significant differences. These results demonstrate that colony insects, which have only been fed with living hens for the last 30 years, are attracted by human skin extracts in a similar way as F1 sylvatic insects.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

American cutaneous leishmaniasis (ACL) is an endemic disease in Northern Argentina. We applied the polymerase chain reaction (PCR) followed by a hybridization labelled probe to 21 paraffin embedded human skin biopsies, already analyzed histologically, from leishmaniasis endemic areas in the province of Tucumán, Argentina. We used primers previously designed to detect a Leishmania-specific 120-base-pair fragment of kinetoplast DNA minicircle, other two primer pairs that amplify kDNA minicircles belonging to the L. braziliensis and L. mexicana complexes respectively, and specific oligonucleotide primers to detect L. (V.) braziliensis which amplify the sequence of the ribosomal protein L-14 of this species. The PCR-hybridization showed a sensitivity of 90.5% when compared to the histopathology test which was 61.9%. Five of the total samples analyzed were positive for the L. braziliensis complex whilst none was positive for the L. mexicana complex. The specific primers for L. (V.) braziliensis detected the parasite in four samples. These results are consistent with those reported for close endemic areas and demonstrate that the causative agent of human leishmaniasis in the analyzed cases was L. (V.) braziliensis. PCR should be used as a diagnostic tool for tegumentary leishmaniasis, especially in the mucosal form, and as a valuable technique for the identification of the Leishmania species that causes the disease in certain areas.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

INTRODUCTION: Fungal infections in human skin, such as sporotrichosis, can occur after fish induced trauma. This work aimed to identify fungi in freshwater fish that are pathogenic to humans. METHODS: Extraction of dental arches from Serrassalmus maculatus (piranha) and Hoplias malabaricus (wolf fish), stings from Pimelodus maculatus (mandis catfish), dorsal fin rays from Plagioscion spp. (corvina) and Tilapia spp., for culture in Mycosel agar. Some cultures were submitted to DNA extraction for molecular identification by sequencing ITS-5.8S rDNA. RESULTS: Cultures identified most yeast as Candida spp., while sequencing also permitted the identification of Phoma spp. and Yarrowia lipolytica. CONCLUSIONS: While the search for S. schenckii was negative, the presence of fungus of the genera Phoma and Candida revealed the pathogenic potential of this infection route. The genus Phoma is involved in certain forms of phaeohyphomycosis, a subcutaneous mycosis caused by dematiaceous fungi, with reports of infections in human organs and systems. Traumatizing structures of some freshwater fish present pathogenic fungi and this may be an important infection route that must be considered in some regions of Brazil, since there are a large number of a fisherman in constant contact with traumatogenic fish.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The outbreak of the jungle or forest yellow fever, through the adapta¬tion, quite recently of the yellow fever virus o the forest mosquitoes, brou¬ght the necessity of ecological researches on hese mosquitoes, as well as on the wild animals they bite, some of them being susceptible to the desease. This has been done by the special yellow fever Service of the State of Sao Paulo, in a special Biological Station in Perús, São Paulo, which has been built in the midst of the jungle. This station was made with plain materials, and covered with straw, but was confortable enough for the technical work, i nthe early months of 1938. During the months in which the investigations were being carried on, the following interesting results were obtained: 1. As we have already pointed out in other places, the forest mosquitoes biting us during daytime, are always new born insects, having not yet sucked blood, as it is the general rule with all mosquitoes, and therefore also, with the anopheles and stegomyia, and this explains why nobody gets malaria or yellow fever, transmitted by anofeles or by aedes aegypti during the day. We think therefore, the jungle yellow fever, got during daytime is not due to the infected jungle or forest mosquito biting, but to infection through the human skin coming into close contact with tre virus, which the forest mosquitoes lay with their dejections, on the leaves of the trees where they remain sitting du¬ring the day. 2. As it is the rule with anopheles, stegomyia and other mosquitoes, the insects once having sucked blood, take nocturnal habits and, therefore, bite us, only during the night, so it happens with the forest mosquito, and insects with developped eggs and blood in stomach have been caught within the sta¬tion house, during the night. During the day, these mosquitoes do not bite, but remain quite still on the leaves of the trees, in the damp parts of the woods. 3. Jungle or forest mosquitoes can easely bite wild animals, some with more avidity then ethers, as it has bee npointed out to the opossum (didei-phis) and other animals. They also bite birds having very thin skin and only exceptionally, cold bloods animals. 5. Is has hot been possible to ascertain how forest mosquitoes are able to live, from onde season to another, through winter, when temperature drops near and even below zero. They have not been found in holes of the terrain, of trees and of animals, as it is the rule in cold countries. During winter, in the forest, it is possible to find larvs in the holes of bambus and trees full of water. As wild animals do not harbour the yellow fever virus for a long time in their body, it is diffcult to explain how the desease lasts from one season to another. Many ecological features on the mosquito, remains yet to be explained and therefore it in necessary to go on with the investigations, in bio¬logical stations, such as that one built up in Perús, São Paulo.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Rove beetles of medical importance in Brazil (Coleoptera, Staphylinidae, Paederinae). The rove beetles of the genus Paederus Fabricius, 1775 are the most important group within Coleoptera causing dermatitis around the world. The medical importance of Paederus depends on its toxic hemolymph released when these beetles are crushed on human skin. The effects are mainly dermatitis linearis and some sporadic cases of conjunctivitis. In Brazil seven species of Paederus are known to cause dermatitis: P. amazonicus Sharp, 1876, P. brasiliensis Erichson, 1840, P. columbinus Laporte, 1835, P. ferus Erichson, 1840, P. mutans Sharp, 1876, P. protensus Sharp, 1876 stat. rev., and Paederus rutilicornis Erichson, 1840. Paederus mutans and P. protensus are for the first time recorded as of medical importance, whereas the record of P. rutilicornis in Brazil is doubtful. All seven species are redescribed and a dichotomous key is provided. The geographic distributions of all species are documented. The results provided here include the most recent and relevant taxonomic revision of Paederus of the Neotropical region, the first identification key for Brazilian species and the increase of recorded species of medical importance in the world.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

A survey for canine tegumentary leishmaniasis (CTL) has been carried out between 1986 and 1993 in seven endemic localities for American cutaneous leishmaniasis in the State of Rio de Janeiro. 270 dogs have been examined for their clinical aspects, the development of delayed hypersensitivity (DHS) with Immunoleish antigen and with immunofluorescent antibody research of IgG (IF). 28.2% of them had ulcer lesions and 3.3% had scars. The lesions consisted of single (39.5%) and mucocutaneous lesions (31.6%), multiple cutaneous (25.0%) and mucocutaneous lesions associated with cutaneous ulcers (4.0%). Twelve (15.8%) isolates from biopsies were analyzed by zimodeme and schizodeme and identified as L. (V.) braziliensis. The overall prevalence of canine infection that was evaluated with the skin test was of 40.5% and with IF it was of 25.5%. Both tests showed a high positive rate with relation to the animals with mucosal lesions, as in the case of human mucocutaneous leishmaniasis. The comparison of the two tests showed the skin test to have a better performance although there was no statistical difference (p>0.05) between them. The proportional sensitivity and specificity was of 84.0% and 74.0%, respectively. The Immunoleish skin test and IF are useful tools to be employed in CTL field epidemiological surveys.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Spleen cells from mice were examined at 5, 10, 15, 20 and 25 days post-infection (dpi) with Dermatobia hominis larva and at 5, 10, 15, 30 and 60 days post-larval emergence (dple). Cell proliferation in vitro assays were carried out with RPMI-1640 medium and larval secretory product (LSP) of D. hominis at 5, 10, 15, 20 and 25 days. When each group of mice was tested against each medium, significance was only seen for 25 dpi, with increasing order: LSP-10 d, -25 d, -5 d, -20 d, -15 d and RPMI. Significant results were also observed when each medium was tested against mice at each dpi or dple. Each dple group vs. each medium produced significant results only for 10 dple, with increasing order: LSP-5 d, -20 d, -25 d, -10 d, -15 d and RPMI. Comparative tests were also carried out between groups to refine certain observations. The LSPs were also analyzed using SDS-PAGE. The results prove that myiasis caused depletion of spleen cells, particularly under the effect of the LSP-10 and -15, but the cells tended to increase up to 60 dple. This in vitro assay may represent the real systemic immune response in the relationship LSP-D. hominis-host.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

To evaluate the effect of BCG vaccination and T lymphocyte subpopulations on the reactivity to the tuberculin skin test, 113 asymtomatic HIV+ individuals were tuberculin tested by intradermal injection of 5TU of purified protein derivative and the levels of circulating lymphocyte (CD3, CD4 and CD8) subpopulations determined by indirect immunofluorescence. Ninety-two percent of the subjects included in the study were males. The mean age of the group was 32.1±7.4 years. Sixty-two percent presented a BCG scar. However, only 22% exhibited positive tuberculin reactions (³5mm) irrespective of the presence of the BCG scar. Tuberculin positive individuals exhibited higher CD4+ cell counts (p=0.004) and CD4+/CD8+ ratios (p=0.006) than tuberculin negative (<5mm) HIV+ individuals. The number of individuals with positive tuberculin reactions was significantly higher in subjects with more than 500 CD4+ lymphocytes/ml (p=0.02) or CD4+/CD8+ ratios ³1.12 (p=0.002). These results suggest that a prior BCG vaccination does not influence the reactivity to the tuberculin skin test in HIV+ asymptomatic individuals and that the number of CD4+ lymphocytes and the CD4+/CD8+ ratio positively correlate with the tuberculin reactivity

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The efficiency of the Mosquito Magnet Liberty PlusTM (MMLP) trap was evaluated in comparison to human-landing catches (HLCs) to sample anopheline populations in Jabillal, state of Bolivar, southern Venezuela. The village comprised 37 houses and a population of 101; malaria in this village is primarily due to Plasmodium vivax and the Annual Parasite Index is 316.8 per 1,000 population. A longitudinal study was conducted between June 2008-January 2009 for three nights per month every two months between 17:30 pm-21:30 pm, a time when biting mosquitoes are most active. Anopheles darlingi and Anopheles nuneztovari were the most common species collected by both methods, whereas Anopheles marajoara was more abundant according to the HLC method. The MMLP trap was more efficient for collecting An. nuneztovari [63%, confidence interval (CI): 2.53] than for collecting An. darlingi (31%, CI: 1.57). There were significant correlations (p < 0.01) between the two methods for An. darlingi [Pearson correlation (R²) = 0.65] and An. nuneztovari (R² = 0.48). These preliminary results are encouraging for further investigations of the use of the MMLP trap for monitoring anopheline populations in remote malaria-endemic areas in the Amazon Basin.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Localised cutaneous leishmaniasis (LCL) is the most common form of cutaneous leishmaniasis characterised by single or multiple painless chronic ulcers, which commonly presents with secondary bacterial infection. Previous culture-based studies have found staphylococci, streptococci, and opportunistic pathogenic bacteria in LCL lesions, but there have been no comparisons to normal skin. In addition, this approach has strong bias for determining bacterial composition. The present study tested the hypothesis that bacterial communities in LCL lesions differ from those found on healthy skin (HS). Using a high throughput amplicon sequencing approach, which allows for better populational evaluation due to greater depth coverage and the Quantitative Insights Into Microbial Ecology pipeline, we compared the microbiological signature of LCL lesions with that of contralateral HS from the same individuals.Streptococcus, Staphylococcus,Fusobacterium and other strict or facultative anaerobic bacteria composed the LCL microbiome. Aerobic and facultative anaerobic bacteria found in HS, including environmental bacteria, were significantly decreased in LCL lesions (p < 0.01). This paper presents the first comprehensive microbiome identification from LCL lesions with next generation sequence methodology and shows a marked reduction of bacterial diversity in the lesions.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The present study evaluates the humoral and cellular immune responses in 35 volunteers submited to short antirabies vaccination schedules with the Fuenzalida & Palacios vaccine based on the administration of doses on non consecutive days. The volunteers were divided into two groups. The first group received a total number of five doses given on days 0, 4, 7, 20 and 35. The other group received four doses, the first one being a double dose given on day 0 and than three other single doses on days 7, 20 and 35. The evaluation of humoral immune response was carried out by serum neutralization (SN) and indirect immunofluorescense (IIF) tests, while the cellular immune response was evaluated by lymphoblastic transformation assay (LTA) and skin test (ST). According to our results these reduced schedules elicited early and effective humoral and cellulafimmune responses to rabies antigen suggesting that new reduced schedules should be extensively studied in order to give the proper bases to the proposition of changes in the current long-term schedule.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

It was reevaluated a reduced schedule for anti-rabies post-exposure immunization with newborn mice nervous tissue vaccine (Fuenzalida 8c Palacios) in a group of 30 non exposed volunteers. The vaccine was administered by intramuscular injections on days zero, 2, 4, 16 and 27, in the deltoid area. Antibody levels were determinated by a simplified serum neutralization microtest on days zero, 16 and 37. On days 16 and 37 the antibody levels of the whole group was >0.5 IU/ml and >1.0 IU/ml, respectively. The cell mediated immunity was precociously detected (on day 4) by the delayed type hipersensitivity skin test. Our results show that this reduced schedule elicited an early and effective humoral and cellular immune response. However it is necessary other studies with larger groups of vaccinees in order to obtain definitive conclusion.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Recent human herpesvirus 6 (HHV-6) infection was detected in cases of exanthem subitum (ES) involving four children, aged 10 to 24 months, between April and August 1994, in Belém, Brazil. By using the indirect immunofluorescence antibody assay (IFA), significant increases (at least eight times) in antibody concentrations were noted from the acute to the convalescent serum samples, with titers ranging from <1:10/1:80 to <1:10/1:640 (patients 3 and 2, respectively). All children had high fever (over 39ºC) for three days, followed by generalized, maculo-papular skin rash. A physical examination of the children also revealed concomitant, cervical lymph node swelling and tonsillar pharyngitis in two of them.