Genetic complementation analysis of two independently isolated hycanthone-resistant strains of Schistosoma mansoni

The objective of this study is to determine whether various hycanthone resistant strains of schistosomes which have been independently isolated are all affected in the same gene. A strain obtained from a Brazilian patient was compared with a strain of Puerto Rican origin selected in the laboratory. If the mutation conferring resistance involved two different genes, one would expect that the progeny of a cross between the two strains would show complementation, i.e. it would be sensitive to the drug. We have performed such a cross and obtained F1 hybrid worms wich were essentially all resistant, thus suggesting that the mutation conferring resistance in the two strains involves the same gene.

Genetic and Antigenic Analysis of Adenovirus Type 3 Strains Showing Intermediate Behavior in Standard Seroneutralization Test

During an epidemiological survey of acute respiratory infection in Rio de Janeiro, among 208 adenovirus isolates, we found two strains that we were not able, by a standard neutralization procedure, to distinguish between type 3 or 7. However, DNA restriction pattern for the two strains with different enzymes were analyzed and showed a typical Ad3h profile. Using a cross-neutralization test in which both Ad3p and Ad7p antisera were used in different concentration against 100 TCID50 of each adenovirus standard and both isolates, we were able to confirm that the two isolates belong to serotype 3. An hemagglutination inhibition test also corroborated the identification of both strains as adenovirus type 3. Comparing Ad3h and Ad3p genome, we observed 16 different restriction enzyme sites, three of which were located in genomic regions encoding polypeptides involved in neutralization sites

Genetic divergence of tomato subsamples

Understanding the genetic variability of a species is crucial for the progress of a genetic breeding program and requires characterization and evaluation of germplasm. This study aimed to characterize and evaluate 101 tomato subsamples of the Salad group (fresh market) and two commercial controls, one of the Salad group (cv. Fanny) and another of the Santa Cruz group (cv. Santa Clara). Four experiments were conducted in a randomized block design with three replications and five plants per plot. The joint analysis of variance was performed and characteristics with significant complex interaction between control and experiment were excluded. Subsequently, the multicollinearity diagnostic test was carried out and characteristics that contributed to severe multicollinearity were excluded. The relative importance of each characteristics for genetic divergence was calculated by the Singh's method (Singh, 1981), and the less important ones were excluded according to Garcia (1998). Results showed large genetic divergence among the subsamples for morphological, agronomic and organoleptic characteristics, indicating potential for genetic improvement. The characteristics total soluble solids, mean number of good fruits per plant, endocarp thickness, mean mass of marketable fruit per plant, total acidity, mean number of unmarketable fruit per plant, internode diameter, internode length, main stem thickness and leaf width contributed little to the genetic divergence between the subsamples and may be excluded in future studies.

The importance to update the guidelines for the use of genetic testing in noncancer patients in Brazil

The Brazilian National Regulatory Agency for Private Health Insurance and Plans has recently published a technical note defining the criteria for the coverage of genetic testing to diagnose hereditary cancer. In this study we show the case of a patient with a breast lesion and an extensive history of cancer referred to a private service of genetic counseling. The patient met both criteria for hereditary breast and colorectal cancer syndrome screening. Her private insurance denied coverage for genetic testing because she lacks current or previous cancer diagnosis. After she appealed by lawsuit, the court was favorable and the test was performed using next-generation sequencing. A deletion of MLH1 exon 8 was found. We highlight the importance to offer genetic testing using multigene analysis for noncancer patients.

Biological and genetic characteristics of uropathogenic Escherichia coli strains

The aim of the present study was to determine biological characteristics such as expression of fimbriae, Congo red binding, production of hemolysin and aerobactin, adhesion to HeLa and uroepithelial cells and invasion of HeLa cells by Escherichia coli isolates obtained from patients showing clinical signs of urinary tract infection (UTI). Also, the presence of genes (apa, afa, spa) for fimbria expression and cytotoxic necrotizing factors (CNF1, CNF2) was assayed using specific primers in PCR. The data obtained were compared with the clonal relationships obtained by analysis of multilocus enzyme electrophoresis (MLEE), restriction fragment length polymorphism (RFLP) of the rDNA (ribotyping) and enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR). All isolates but one presented a combination of at least two of the characteristics studied, a fact suggesting the presence of pathogenicity islands (PAIs). Diffuse adherence type to HeLa cells was observed to occur in most of the strains, but adhesion to uroepithelial cells seems to be a more reliable test to verify pathogenicity. Although four strains seemed to be able to invade HeLa cells when assayed by light microscopy, electron microscopy studies demonstrated that these strains were not invasive. MLEE, RFLP and ERIC-PCR were able to group the isolates differently into main clusters that were not correlated with the presence of pathogenic traits.

Antigenic and genetic characterization of the first rabies virus isolated from the bat Eumops perotis in Brazil

Although the main transmitters of rabies in Brazil are dogs and vampire bats, the role of other species such as insectivorous and frugivorous bats deserves special attention, as the rabies virus has been isolated from 36 bat species. This study describes the first isolation of the rabies virus from the insectivorous bat Eumops perotis. The infected animal was found in the city of Ribeirão Preto, São Paulo. The virus was identified by immunofluorescence antibody test (FAT) in central nervous system (CNS) samples, and the isolation was carried out in N2A cell culture and adult mice. The sample was submitted to antigenic typing using a panel of monoclonal antibodies (CDC/Atlanta/USA). The DNA sequence of the nucleoprotein gene located between nucleotides 102 and 1385 was aligned with homologous sequences from GenBank using the CLUSTAL/W method, and the alignment was used to build a neighbor-joining distance-based phylogenetic tree with the K-2-P model. CNS was negative by FAT, and only one mouse died after inoculation with a suspension from the bat's CNS. Antigenic typing gave a result that was not compatible with the patterns defined by the panel. Phylogenetic analysis showed that the virus isolated segregated into the same cluster related to other viruses isolated from insectivorous bats belonging to genus Nyctinomops ssp. (98.8% nucleotide identity with each other).

PRELIMINARY REPORT ON THE PUTATIVE ASSOCIATION OF IL10 -3575 T/A GENETIC POLYMORPHISM WITH MALARIA SYMPTOMS

Only a small percentage of individuals living in endemic areas develop severe malaria suggesting that host genetic factors may play a key role. This study has determined the frequency of single nucleotide polymorphisms (SNPs) in some pro and anti-inflammatory cytokine gene sequences: IL6 (-174; rs1800795), IL12p40 (+1188; rs3212227), IL4 (+33; rs2070874), IL10 (-3575; rs1800890) and TGFb1 (+869; rs1800470), by means of PCR-RFLP. Blood samples were collected from 104 symptomatic and 37 asymptomatic subjects. Laboratory diagnosis was assessed by the thick blood smear test and nested-PCR. No association was found between IL6 (-174), IL12p40 (+1188), IL4 (+33), IL10 (- 3575), TGFb1 (+869) SNPs and malaria symptoms. However, regarding the IL10 -3575 T/A SNP, there were significantly more AA and AT subjects, carrying the polymorphic allele A, in the symptomatic group (c2 = 4.54, p = 0.01, OR = 0.40 [95% CI - 0.17- 0.94]). When the analysis was performed by allele, the frequency of the polymorphic allele A was also significantly higher in the symptomatic group (c2 = 4.50, p = 0.01, OR = 0.45 [95% CI - 0.21-0.95]). In conclusion, this study has suggested the possibility that the IL10 - 3575 T/A SNP might be associated with the presence and maintenance of malaria symptoms in individuals living in endemic areas. Taking into account that this polymorphism is related to decreased IL10 production, a possible role of this SNP in the pathophysiology of malaria is also suggested, but replication studies with a higher number of patients and evaluation of IL10 levels are needed for confirmation.

Morphometric and genetic differentiation among populations of Eupemphix nattereri (Amphibia, Anura, Leiuperidae) from central Brazil

To assess genetic structure and phenotypic diversity of Eupemphix nattereri Steindachner, 1863, morphometric and molecular analyses were carried out for nine populations from the State of Goiás. A total of 11 morphometric traits were evaluated and genetic information was estimated using RAPD markers. Genetic and phenotypic distances were determined as a function of geographical origin. Correlation among genetic, morphometric, micro, and macroenviromental were analyzed by the Mantel test. Genetic data indicated high levels of genetic diversity (Φst= 0.3) among the nine populations. Mantel tests did not reveal a significant positive correlation between genetic and geographical distances, indicating that locally geographical populations were not genetically similar, even in distances smaller than 50 km. Discriminant analysis on 11 morphometric measurements showed a high divergence among the nine populations. However, a marginally significant correlation (P=0.08) between genetic and morphometric distances was found. The observed correlation was not causal in terms of the relationship between phenotype and genotype, but indicated common spatial structures. Thus, our results suggest that isolation-by-distance processes may explain population divergence in Eupemphix nattereri.

Analysis of genetic diversity of Trypanosoma cruzi: an application of riboprinting and gradient gel electrophoresis methods

Analysis of restriction fragment length polymorphism (RFLP) profiles derived from digestion of polymerase chain reaction (PCR) products of the ribosomal 18S from Trypanosoma cruzi yields a typical `riboprint' profile that can vary intraspecifically. A selection of 21 stocks of T. cruzi and three outgroup taxa: T. rangeli, T. conorhini and Leishmania braziliensis were analysed by riboprinting to assess divergence within and between taxa. T. rangeli, T. conorhini and L. braziliensis could be easily differentiated from each other and from T. cruzi. Phenetic analysis of PCR-RFLP profiles indicated that, with one or two exceptions, stocks of T. cruzi could be broadly partitioned into two groups that formally corresponded to T. cruzi I and T. cruzi II respectively. To test if ribosomal 18S sequences were homogeneous within each taxon, gradient gel electrophoresis methods were employed utilising either chemical or temperature gradients. Upon interpretation of the melting profiles of riboprints and a section of the 18S independently amplified by PCR, there would appear to be at least two divergent 18S types present within T. cruzi. Heterogeneity within copies of the ribosomal 18S within a single genome has therefore been demonstrated and interestingly, this dimorphic arrangement was also present in the outgroup taxa. Presumably the ancestral duplicative event that led to the divergent 18S types preceded that of speciation within this group. These divergent 18S paralogues may have, or had, different functional pressures or rates of molecular evolution. Whether or not these divergent types are equally transcriptionally active throughout the life cycle, remain to be assessed.

Crossing experiments detect genetic incompatibility among populations of Triatoma brasiliensis Neiva, 1911 (Heteroptera, Reduviidae, Triatominae)

Triatoma brasiliensis is composed of at least four geographic populations (brasiliensis, melanica, macromelasoma, and juazeiro) that have distinct chromatic, morphologic, biologic and ecologic patterns, and genetic composition. Reciprocal crosses between all pairwise combinations were carried out in order to evaluate the genetic and reproductive compatibility of these four populations. The F1 individuals developed normally and the resulting adults were crossed again to test the F2 and F3 viability. Genetic incompatibility was found between melanica and brasiliensis populations.

Genetic variability in the 5' UTR and NS5A regions of hepatitis C virus RNA isolated from non-responding and responding patients with chronic HCV genotype 1 infection

Sequence variation among different hepatitis C virus (HCV) isolates has adaptive significance and reflects the modes and intensities of selection mechanisms operating on the virus. In this work, we sought to investigate using classical population genetics parameters, the genetic variability of HCV genotype 1 using the 5' UTR and NS5A regions from treatment non-responding and responding groups of patients. Both regions showed low genetic varia-bility and the 5' UTR showed neutral deviation. No differences were observed in the nonsynonymous/synonymous nucleotide substitution ratio among groups for NS5A. The analysis of molecular variance test of the 5' UTR region showed an 11.94% variation among groups. Phylogenetic analysis showed no correlation between sequence variations and therapeutic responses.

Genetic diversity of NS3 protease from Brazilian HCV isolates and possible implications for therapy with direct-acting antiviral drugs

The hepatitis C virus (HCV) NS3 protease has been one of the molecular targets of new therapeutic approaches. Its genomic sequence variability in Brazilian HCV isolates is poorly documented. To obtain more information on the magnitude of its genetic diversity, 114 Brazilian HCV samples were sequenced and analysed together with global reference sequences. Genetic distance (d) analyses revealed that subtype 1b had a higher degree of heterogeneity (d = 0.098) than subtypes 1a (d = 0.060) and 3a (d = 0.062). Brazilian isolates of subtype 1b were distributed in the phylogenetic tree among sequences from other countries, whereas most subtype 1a and 3a sequences clustered into a single branch. Additional characterisation of subtype 1a in clades 1 and 2 revealed that all but two Brazilian subtype 1a sequences formed a distinct and strongly supported (approximate likelihood-ratio test = 93) group of sequences inside clade 1. Moreover, this subcluster inside clade 1 presented an unusual phenotypic characteristic in relation to the presence of resistance mutations for macrocyclic inhibitors. In particular, the mutation Q80K was found in the majority of clade 1 sequences, but not in the Brazilian isolates. These data demonstrate that Brazilian HCV subtypes display a distinct pattern of genetic diversity and reinforce the importance of sequence information in future therapeutic approaches.

Genetic variation in the Cytbgene of human cerebral Taenia soliumcysticerci recovered from clinically and radiologically heterogeneous patients with neurocysticercosis

Neurocysticercosis (NC) is a clinically and radiologically heterogeneous parasitic disease caused by the establishment of larval Taenia solium in the human central nervous system. Host and/or parasite variations may be related to this observed heterogeneity. Genetic differences between pig and human-derived T. solium cysticerci have been reported previously. In this study, 28 cysticerci were surgically removed from 12 human NC patients, the mitochondrial gene that encodes cytochrome b was amplified from the cysticerci and genetic variations that may be related to NC heterogeneity were characterised. Nine different haplotypes (Ht), which were clustered in four haplogroups (Hg), were identified. Hg 3 and 4 exhibited a tendency to associate with age and gender, respectively. However, no significant associations were found between NC heterogeneity and the different T. solium cysticerci Ht or Hg. Parasite variants obtained from patients with similar NC clinical or radiological features were genetically closer than those found in groups of patients with a different NC profile when using the Mantel test. Overall, this study establishes the presence of genetic differences in the Cytb gene of T. solium isolated from human cysticerci and suggests that parasite variation could contribute to NC heterogeneity.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Genetic variability of the Brazilian hair sheep breeds

The objectives of this work were to investigate the genetic structure of the Brazilian hair sheep breeds and to determine the origin of the Santa Inês breed. Molecular similarity was determined using Randomly Amplified Polymorphic DNA - Polymerase Chain Reaction markers in 238 individuals from five naturalized sheep breeds: Santa Inês (48 animals), Rabo Largo (48), Somali (48), Morada Nova (48) and Bergamasca (46), collected in Goiás, Sergipe, Bahia, and Ceará States as well as in the Federal District. Fifty-four loci were selected from 19 primers, after a pilot test using 140 primers. Qualitative analyses indicate diagnostic markers for all breeds. All breeds were significantly different from each other. Interbreed differences were explained by 14.92% of the total variation. Santa Inês clustered with Bergamasca (97% bootstrap) and with Rabo Largo, composing the third member of the group (81% bootstrap) while Morada Nova and Somali breeds clustered separately. Each breed should be considered as a separate management and conservation unit, and special care should be taken with Rabo Largo, Morada Nova and Somali breeds, represented by small herds in Brazil.