178 resultados para GT-rich DNA

em Scielo Saúde Pública - SP


Relevância:

30.00% 30.00%

Publicador:

Resumo:

INTRODUCTION: The study analyzed positivity of polymerase chain reaction (PCR) on detection of DNA from Leishmania in patients' samples. METHODS: Extracted DNA was submitted to L150/L152, 13Y/13Z, and seminested PCR (snPCR). RESULTS: Results were evidenced by bands of approximately 120, 720, and 670 bp for L150/L152, 13Y/13Z, and snPCR, respectively. L150/L152, 13Y/13Z, and snPCR positivity indexes were 76.9, 56.4, and 9.2 (p>0.05), respectively, for suspected and 93.7, 68.7, and 84.4 (p<0.05), respectively, for confirmed. CONCLUSIONS: Preliminary results showed that these assays, mainly L150/L152 and snPCR, can detect Leishmania DNA and carry potential on laboratory diagnosis of leishmaniasis.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The genetic diversity displayed by Plasmodium falciparum, the most deadly Plasmodium species, is a significant obstacle for effective malaria vaccine development. In this study, we identified genetic polymorphisms in P. falciparum glutamate-rich protein (GLURP), which is currently being tested in clinical trials as a malaria vaccine candidate, from isolates found circulating in the Brazilian Amazon at variable transmission levels. The study was performed using samples collected in 1993 and 2008 from rural villages situated near Porto Velho, in the state of Rondônia. DNA was extracted from 126 P. falciparum-positive thick blood smears using the phenol-chloroform method and subjected to a nested polymerase chain reaction protocol with specific primers against two immunodominant regions of GLURP, R0 and R2. Only one R0 fragment and four variants of the R2 fragment were detected. No differences were observed between the two time points with regard to the frequencies of the fragment variants. Mixed infections were uncommon. Our results demonstrate conservation of GLURP-R0 and limited polymorphic variation of GLURP-R2 in P. falciparum isolates from individuals living in Porto Velho. This is an important finding, as genetic polymorphisms in B and T-cell epitopes could have implications for the immunological properties of the antigen.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Resumo:O colapso induzido pelo exercício (EIC) é considerado uma síndrome autossômica recessiva que afeta principalmente cães da raça Labrador Retriever. A doença é caracterizada por fraqueza muscular e colapso após exercício intenso. Usualmente, ocorre recuperação clínica após o episódio, mas alguns animais podem vir a óbito. Os sinais clínicos são decorrentes do polimorfismo de base única (SNP) c.767G>T no gene Dynamin 1 (DNM1). O objetivo deste trabalho foi determinar a ocorrência deste SNP em 321 cães da raça Labrador Retriever do Estado de São Paulo. Primers específicos para a amplificação de todo o exon 6 do gene DNM1 foram usados nas PCRs utilizando DNA a partir de amostras de sangue ou swab bucal, a avaliação final foi realizada com sequenciamento direto dos produtos da PCR. Dentre os 321 animais estudados, 3,4 % (11/321) eram homozigotos para o SNP c.767G>T no gene DNM1 e 24,6% (79/321) eram heterozigotos. Somente um dos 11 animais homozigotos apresentavam sinais clínicos compatíveis com a EIC. Este é o primeiro estudo sobre a ocorrência deste SNP no Brasil e considerando que quase 25% dos animais estudados eram heterozigotos, a genotipagem dos animais para este SNP pode ser importante antes dos acasalamentos para cães desta raça. A EIC deve ser considerada nos diagnósticos diferenciais de enfermidades neuromusculares em cães da raça Labrador Retriever.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Abstract: Dermatosparaxis is an autosomal recessive disorder of connective tissue; the disorder is clinically characterized by skin fragility and hyperextensibility. Dermatosparaxis in White Dorper sheep is caused by a single nucleotide polymorphism (SNP) (c.421G>T) in the ADAM metalloproteinase with thrombospondin type 1 motif, 2 (ADAMTS2) gene. The aim of this study was to investigate the prevalence of this SNP in a White Dorper herd in São Paulo state, Brazil. In this study, we collected blood DNA samples from 303 White Dorper sheep and performed polymerase chain reaction to amplify the SNP region. The samples were sequenced to determine the presence of the SNP in the ADAMTS2 gene. The SNP prevalence in the studied population was 15.5%; this finding indicates that more effective control measures should be used to prevent the inheritance of SNP c.421G>T in the ADAMTS2 gene in Brazilian White Dorper herds.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The human androgen receptor (AR) gene promoter lies in a GC-rich region containing two principal sites of transcription initiation and a putative Sp1 protein-binding site, without typical "TATA" and "CAAT" boxes. It has been suggested that mutations within the 5'untranslated region (5'UTR) may contribute to the development of prostate cancer by changing the rates of gene transcription and/or translation. In order to investigate this question, the aim of the present study was to search for the presence of mutations or polymorphisms at the AR-5'UTR in 92 prostate cancer patients, where histological diagnosis of adenocarcinoma was established in specimens obtained from transurethral resection or after prostatectomy. The AR-5'UTR was amplified by PCR from genomic DNA samples of the patients and of 100 healthy male blood donors, included as controls. Conformation-sensitive gel electrophoresis was used for DNA sequence alteration screening. Only one band shift was detected in one individual from the blood donor group. Sequencing revealed a new single nucleotide deletion (T) in the most conserved portion of the promoter region at position +36 downstream from the transcription initiation site I. Although the effect of this specific mutation remains unknown, its rarity reveals the high degree of sequence conservation of the human androgen promoter region. Moreover, the absence of detectable variation within the critical 5'UTR in prostate cancer patients indicates a low probability of its involvement in prostate cancer etiology.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The features of the nucleotide sequences in both replication and promoter regions have been investigated in many organisms. Intrinsically bent DNA sites associated with transcription have been described in several prokaryotic organisms. The aim of the present study was to investigate intrinsic bent DNA sites in the segment that holds the chromosomal replication origin, oriC, of Xylella fastidiosa 9a5c. Electrophoretic behavior analyses, as well as in silico analyses of both the 2-D projection and helical parameters, were performed. The chromosomal segment analyzed contains the initial sequence of the rpmH gene, an intergenic region, the dnaA gene, the oriC sequence, and the 5' partial sequence of the dnaN gene. The analysis revealed fragments with reduced electrophoretic mobility, which indicates the presence of curved DNA segments. The analysis of the helical parameter ENDS ratio revealed three bent DNA sites (b1, b2, and b3) located in the rpmH-dnaA intergenic region, the dnaA gene, and the oriC 5' end, respectively. The chromosomal segment of X. fastidiosa analyzed here is rich in phased AT tracts and in CAnT motifs. The 2-D projection indicated a segment whose structure was determined by the cumulative effect of all bent DNA sites. Further, the in silico analysis of the three different bacterial oriC sequences indicated similar negative roll and twist >34.00° values. The DnaA box sequences, and other motifs in them, may be associated with the intrinsic DNA curvature.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We determined the influence of fasting (FAST) and feeding (FED) on cholesteryl ester (CE) flow between high-density lipoproteins (HDL) and plasma apoB-lipoprotein and triacylglycerol (TG)-rich emulsions (EM) prepared with TG-fatty acids (FAs). TG-FAs of varying chain lengths and degrees of unsaturation were tested in the presence of a plasma fraction at d > 1.21 g/mL as the source of CE transfer protein. The transfer of CE from HDL to FED was greater than to FAST TG-rich acceptor lipoproteins, 18% and 14%, respectively. However, percent CE transfer from HDL to apoB-containing lipoproteins was similar for FED and FAST HDL. The CE transfer from HDL to EM depended on the EM TG-FA chain length. Furthermore, the chain length of the monounsaturated TG-containing EM showed a significant positive correlation of the CE transfer from HDL to EM (r = 0.81, P < 0.0001) and a negative correlation from EM to HDL (r = -041, P = 0.0088). Regarding the degree of EM TG-FAs unsaturation, among EMs containing C18, the CE transfer was lower from HDL to C18:2 compared to C18:1 and C18:3, 17.7%, 20.7%, and 20%, respectively. However, the CE transfer from EMs to HDL was higher to C18:2 than to C18:1 and C18:3, 83.7%, 51.2%, and 46.3%, respectively. Thus, the EM FA composition was found to be the rate-limiting factor regulating the transfer of CE from HDL. Consequently, the net transfer of CE between HDL and TG-rich particles depends on the specific arrangement of the TG acyl chains in the lipoprotein particle core.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Esophageal cancer (EC) is a common malignancy worldwide. The X-ray repair cross-complementing 1 gene (XRCC1) is one of the most important candidate genes for influencing susceptibility to EC. This study aimed to investigate the effect of XRCC1 genetic variants on susceptibility to EC. A total of 383 EC patients (males: 239, females: 144, mean age: 56.62) and 387 cancer-free controls (males: 251, females: 136, mean age: 58.23) were enrolled in this study. The c.910A>G genetic variant of theXRCC1 gene was determined by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing methods. The allele and genotype frequencies indicated statistical differences between EC patients and cancer-free controls. The c.910A>G genetic variant was statistically associated with increased susceptibility to EC [GGvs AA: odds ratio (OR)=1.79, 95% confidence interval (CI)=1.12-2.86, P=0.014; GG vs AG/AA: OR=1.76, 95%CI=1.13-2.75, P=0.013; G vs A: OR=1.25, 95%CI=1.01-1.55, P=0.041]. The allele G and genotype GG could contribute to the increased susceptibility to EC. Our findings suggest that the c.910A>G genetic variant is associated with susceptibility to EC in the Chinese Han population, and might be used as a molecular marker for detecting susceptibility to EC.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The aim of this study was to determine the influence of process parameters and Passion Fruit Fiber (PFF) addition on the Glycemic Index (GI) of an extruded breakfast cereal. A 2³ Central Composite Rotational Design (CCRD) was used, with the following independent variables: raw material moisture content (18-28%), 2nd and 3rd barrel zone temperatures (120-160 ºC), and PFF (0-30%). Raw materials (organic corn flour and organic PFF) were characterized as to their proximate composition, particle size, and in vitro GI. The extrudates were characterized as to their in vitro GI. The Response Surface Methodology (RSM) and Principal Component Analysis (PCA) were used to analyze the results. Corn flour and PFF presented 8.55 and 7.63% protein, 2.61 and 0.60% fat, 0.52 and 6.17% ash, 78.77 and 78.86% carbohydrates (3 and 64% total dietary fiber), respectively. The corn flour particle size distribution was homogeneous, while PFF presented a heterogeneous particle size distribution. Corn flour and PFF presented values of GI of 48 and 45, respectively. When using RSM, no effect of the variables was observed in the GI of the extrudates (average value of 48.41), but PCA showed that the GI tended to be lower when processing at lower temperatures (<128 ºC) and at higher temperatures (>158 ºC). When compared to white bread, the extrudates showed a reduction of the GI of up to 50%, and could be considered an interesting alternative in weight and glycemia control diets.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The '10/90 gap' was first highlighted by the Global Forum for Health Research. It refers to the finding that 90% of worldwide medical research expenditure is targeted at problems affecting only 10% of the world's population. Applying research results from the rich world to the problems of the poor may be a tempting, potentially easy and convenient solution for this gap. This paper had the objective of presenting arguments that such an approach runs the risk of exporting failure. Health interventions that are shown to be effective in the specific context of a Western industrialized setting will not necessarily work in the developing world.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Foi realizado diagnóstico para leishmaniose tegumentar americana a partir de sangue de pacientes residentes em dois municípios endêmicos do estado de Pernambuco. O DNA de 119 amostras de sangue foi extraído e submetido a reação em cadeia da polimerase. Utilizaram-se primers do minicírculo do DNA do cinetoplasto (kDNA) de Leishmania braziliensis, circulante em Pernambuco, cuja seqüência-alvo gera um fragmento de 750 pares de bases. No total 58 (48,7%) indivíduos apresentaram amplificação positiva e 61 (51,3%) negativa. Das amostras positivas para a PCR, 37 (≅ 64%) pertenciam a indivíduos tratados e sem lesão. Conclui-se que a técnica de PCR é eficaz para identificar o DNA de leishmânia em material de biópsias e em sangue venoso.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The detection of HBV-DNA in serum by molecular hybridization is the most sensitive and specific marker of replication and infectivity of hepatitis B virus and currently is proposed as a routine diagnostic technique in the follow-up of HBV - related diseases. Comparing different techniques already described, we found that direct spotting of serum samples on nitrocellulose membranes under vacuum filtration, followed by denaturing and neutralizing washes is more practical, simple, sensible and reproducible. DNA polymerase assay using phosphonoformic acid as specific viral inhibitor has shown 86.8% of concordance with HBV-DNA detection, and so, it is an useful alternative in the follow-up of hepatitis B chronic patients. We found 19.2% HBeAg positive samples with no other markers of viral replication and no anti-HBe positive sample had detectable HBV-DNA. Discordance between the 2 systems have been extensively described, and we confirm this for the first time in our country. Molecular biological techniques are essential to determine the replication status of chronic hepatitis B patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Serum samples from 356 HBsAg positive asymptomatic carriers, which were titrated by reverse passive hemagglutination, were analysed for the presence of HBV-DNA, HBsAg and IgM anti-HBc. The samples were divided in three classes, according to the titers of HBsAg and IgM anti-HBc and the distribution of HBV-DNA and HBsAg among these classes was studied. In the high titer class of HBsAg, 65% of samples have one or both markers against only 19% in the low titer class. From the total of 356 samples, 121 gave positive results for IgM anti-HBc (33.9%). From these, 38.9% of HBV-DNA and 47.9% of HBeAg were observed, whereas in samples with absence of IgM anti-HBc, 18.3% and 16.6% were respectively found. A higher frequency of agreement between all these markers was found in the class of high titers of HBsAg; however, HBV-DNA was detected in the low titer class of HBsAg and little or no IgM anti-HBc, showing potential blood infectivity even in HBsAg positive borderline samples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Specimens from cervical dysplasias or carcinomas and genital condylomata acuminata were retrospectively analysed by in situ hybridization (ISH) with bioti-nylated DNA probes for human papillomavirus (HPV) types 6, 11, 16 and 18. In the control group no case was positive for HPV DNA. In mild/moderate dysplasias, 4 cases (14%) were positive for HPV 6 or 11 and 2 cases (7%), for HPV 16. In the severe dysplasia/in situ carcinoma group, 9 cases (31%) showed presence of DNA of HPV types 16 or 18. Six invasive carcinomas (20%) were positive for HPV type 16 or 18. Among condylomata acuminata, 22 cases (73%) were positive for HPV types 6 or 11. In all ISH-positive cases only one viral type was detected. No correlation between HPV DNA positivity and histological findings of HPV infection was observed. Although less sensitive than some other molecular biology techniques, in situ hybridization with biotinylated DNA probes proved to be simple and useful for detecting and typing HPV in samples routinely received for histopathological analysis.