68 resultados para GENE SILENCING
em Scielo Saúde Pública - SP
Resumo:
Overexpression of cytokine-induced apoptosis inhibitor 1 (CIAPIN1) contributes to multidrug resistance (MDR) in breast cancer. This study aimed to evaluate the potential of CIAPIN1 gene silencing by RNA interference (RNAi) as a treatment for drug-resistant breast cancer and to investigate the effect of CIAPIN1 on the drug resistance of breast cancer in vivo. We used lentivirus-vector-based RNAi to knock down CIAPIN1 in nude mice bearing MDR breast cancer tumors and found that lentivirus-vector-mediated silencing of CIAPIN1 could efficiently and significantly inhibit tumor growth when combined with chemotherapy in vivo. Furthermore, Western blot analysis showed that both CIAPIN1 and P-glycoprotein expression were efficiently downregulated, and P53 was upregulated, after RNAi. Therefore, we concluded that lentivirus-vector-mediated RNAi targeting of CIAPIN1 is a potential approach to reverse MDR of breast cancer. In addition, CIAPIN1 may participate in MDR of breast cancer by regulating P-glycoprotein and P53 expression.
Resumo:
Small nucleolar RNAs (snoRNAs) are small non-coding RNAs that modify RNA molecules such as rRNA and snRNA by guiding 2'-O-ribose methylation (C/D box snoRNA family) and pseudouridylation reactions (H/ACA snoRNA family). H/ACA snoRNAs are also involved in trans-splicing in trypanosomatids. The aims of this work were to characterise the Cl gene cluster that encodes several snoRNAs in Trypanosoma rangeli and compare it with clusters from Trypanosoma cruzi, Trypanosoma brucei, Leishmania major, Leishmania infantum, Leishmania braziliensis and Leptomonas collosoma. The T. rangeli Cl gene cluster is an 801 base pair (bp) repeat sequence that encodes three C/D (Cl1, Cl2 and Cl4) and three H/ACA (Cl3, Cl5 and Cl6) snoRNAs. In contrast to T. brucei, the Cl3 and Cl5 homologues have not been annotated in the Leishmania or T. cruzi genome projects (http//:www.genedb.org). Of note, snoRNA transcribed regions have a high degree of sequence identity among all species and share gene synteny. Collectively, these findings suggest that the Cl cluster could constitute an interesting target for therapeutic (gene silencing) or diagnostic intervention strategies (PCR-derived tools).
Resumo:
SUMMARY High-risk human papillomavirus (hr-HPV) infection is necessary but not sufficient for cervical cancer development. Recently, P16INK4A gene silencing through hypermethylation has been proposed as an important cofactor in cervical carcinogenesis due to its tumor suppressor function. We aimed to investigate P16INK4A methylation status in normal and neoplastic epithelia and evaluate an association with HPV infection and genotype. This cross-sectional study was performed with 141 cervical samples from patients attending Hospital Moncorvo Filho, Rio de Janeiro. HPV detection and genotyping were performed through PCR and P16INK4A methylation by nested-methylation specific PCR (MSP). HPV frequency was 62.4% (88/141). The most common HPV were HPV16 (37%), HPV18 (16.3%) and HPV33/45(15.2%). An upward trend was observed concerning P16INK4A methylation and lesion degree: normal epithelia (10.7%), low grade lesions (22.9%), high grade (57.1%) and carcinoma (93.1%) (p < 0.0001). A multivariate analysis was performed to evaluate an association between methylation, age, tobacco exposure, HPV infection and genotyping. A correlation was found concerning methylation with HPV infection (p < 0.0001), hr-HPV (p = 0.01), HSIL (p < 0.0007) and malignant lesions (p < 0.0001). Since viral infection and epigenetic alterations are related to cervical carcinoma, we suggest that P16INK4A methylation profile maybe thoroughly investigated as a biomarker to identify patients at risk of cancer.
Resumo:
Viruses of to the family Geminiviridae are considered some of the most important pathogens in tropical and subtropical regions of the world. Members of one Geminiviridae genus, Begomovirus, have been causing severe losses, particularly in tomato (Lycopersicon esculentum) production in the Americas and the Caribbean. Several new begomoviruses have been reported in the region and, at least one, Tomato yellow leaf curl virus (TYLCV), has been brought in from the Old World via infected transplants. In addition, the recombination events that are playing an important role in Begomovirus diversity have increased the complexity of their control. This scenario has led to the search for control measures that go beyond traditional host genetic resistance, chemical controls and cultural practices. In this review, besides the recommended classical control measures, transgenic approaches will be discussed, as well as the mechanisms involved in their successful control of viruses.
Resumo:
Sixteen transgenic yellow passionfruit (Passiflora spp.) plants (R0) were obtained which express a non-translatable transgenic RNA corresponding to the 3' region of the NIb gene and the 5' region of the CP gene, derived from the genome of a Brazilian isolate of Cowpea aphid-borne mosaic virus (CABMV). The transgenic plants were propagated by stem cuttings and challenged by sap inoculation with isolates CABMV-MG1 and CABMV-PE1. One transgenic plant (TE5-10) was resistant to the isolate CABMV-MG1, but susceptible to CABMV-PE1. The remaining transgenic plants developed systemic symptoms, equal to non-transformed plants, when inoculated with either isolate. The absence of virus in TE5-10 plants was confirmed by indirect ELISA. Transcription analysis of the transgene demonstrated that the TE5-10 plant did not accumulate transgenic mRNA, even before inoculation. After inoculation, viral RNA was only detected in plants inoculated with CABMV-PE1. These results confirm that the transgenic plant TE5-10 is resistant to isolate CABMV-MG1, and suggest that the resistance mechanism is post-transcriptional gene silencing, which is already activated in the transgenic plants before virus inoculation.
Resumo:
Two Lettuce mosaic virus isolates capable of overcoming the resistance afforded by the resistance gene mo1² in lettuce, LMV-AF199 from Brazil, and LMV-E, an European isolate, were evaluated for the rapidity and severity of symptoms induced on the lettuce variety Salinas 88 (mo1²). The mosaic symptoms on Salinas 88 plants inoculated with LMV-AF199 appeared 7 days post-inoculation (dpi) and 15 dpi for LMV-E. The symptoms induced by LMV-AF199 in this cultivar were also more severe than those induced by LMV-E. In order to identify the region of the viral genome responsible for this phenotype, recombinant viruses were constructed between these isolates and the phenotype of each recombinant was analysed. The region encoding proteins P1 and HcPro from LMV-AF199 was associated with the increased virulence in Salinas 88.
Resumo:
The discovery of double-stranded RNA-mediated gene silencing has rapidly led to its use as a method of choice for blocking a gene, and has turned it into one of the most discussed topics in cell biology. Although still in its infancy, the field of RNA interference has already produced a vast array of results, mainly in Caenorhabditis elegans, but recently also in mammalian systems. Micro-RNAs are short hairpins of RNA capable of blocking translation, which are transcribed from genomic DNA and are implicated in several aspects from development to cell signaling. The present review discusses the main methods used for gene silencing in cell culture and animal models, including the selection of target sequences, delivery methods and strategies for a successful silencing. Expected developments are briefly discussed, ranging from reverse genetics to therapeutics. Thus, the development of the new paradigm of RNA-mediated gene silencing has produced two important advances: knowledge of a basic cellular mechanism present in the majority of eukaryotic cells and access to a potent and specific new method for gene silencing.
Resumo:
Small cell lung cancer (SCLC) is an aggressive disease, representing 15% of all cases of lung cancer, has high metastatic potential and low prognosis that urgently demands the development of novel therapeutic approaches. One of the proposed approaches has been the down-regulation of BCL2, with poorly clarified and controversial therapeutic value regarding SCLC. The use of anti-BCL2 small interfering RNA (siRNA) in SCLC has never been reported. The aim of the present study was to select and test the in vitro efficacy of anti-BCL2 siRNA sequences against the protein and mRNA levels of SCLC cells, and their effects on cytotoxicity and chemosensitization. Two anti-BCL2 siRNAs and the anti-BCL2 G3139 oligodeoxynucleotide (ODN) were evaluated in SCLC cells by the simultaneous determination of Bcl-2 and viability using a flow cytometry method recently developed by us in addition to Western blot, real-time reverse-transcription PCR, and cell growth after single and combined treatment with cisplatin. In contrast to previous reports about the use of ODN, a heterogeneous and up to 80% sequence-specific Bcl-2 protein knockdown was observed in the SW2, H2171 and H69 SCLC cell lines, although without significant sequence-specific reduction of cell viability, cell growth, or sensitization to cisplatin. Our results question previous data generated with antisense ODN and supporting the present concept of the therapeutic interest in BCL2 silencing per se in SCLC, and support the growing notion of the necessity of a multitargeting molecular approach for the treatment of cancer.
Resumo:
Protein phosphatase magnesium/manganese-dependent 1D (PPM1D) is a p53-induced phosphatase that functions as a negative regulator of stress response pathways and has oncogenic properties. However, the functional role ofPPM1D in bladder cancer (BC) remains largely unknown. In the present study, lentivirus vectors carrying small hairpin RNA (shRNA) targeting PPM1D were used to explore the effects ofPPM1D knockdown on BC cell proliferation and tumorigenesis. shRNA-mediated knockdown of PPM1D significantly inhibited cell growth and colony forming ability in the BC cell lines 5637 and T24. Flow cytometric analysis showed that PPM1D silencing increased the proportion of cells in the G0/G1 phase. Downregulation of PPM1Dalso inhibited 5637 cell tumorigenicity in nude mice. The results of the present study suggest that PPM1D plays a potentially important role in BC tumorigenicity, and lentivirus-mediated delivery of shRNA againstPPM1D might be a promising therapeutic strategy for the treatment of BC.
Resumo:
Anti-silencing factor 1 (ASF1) is a histone chaperone that contributes to the histone deposition during nucleosome assembly in newly replicated DNA. It is involved in chromatin disassembly, transcription activation and in the cellular response to DNA damage. In Leishmania major the ASF1 gene (LmASF1) is located in chromosome 20 and codes for a protein showing 67% of identity with the Trypanosoma brucei TbASF1a. Compared to orthologous proteins, LmASF1 conserves the main residues relevant for its various biological functions. To study ASF1 in Leishmania we generated a mutant overexpressing LmASF1 in L. major. We observed that the excess of LmASF1 impaired promastigotes growth rates and had no impact on cell cycle progress. Differently from yeast, ASF1 overproduction in Leishmania did not affect expression levels of genes located on telomeres, but led to an upregulation of proteins involved in chromatin remodelling and physiological stress, such as heat shock proteins, oxidoreductase activity and proteolysis. In addition, we observed that LmASF1 mutant is more susceptible to the DNA damaging agent, methyl methane sulphonate, than the control line. Therefore, our study suggests that ASF1 from Leishmania pertains to the chromatin remodelling machinery of the parasite and acts on its response to DNA damage.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
OBJETIVO: Estimar o incremento no número adicional de afetados com base na prevalência de síndromes falciformes em familiares de casos-índice. MÉTODOS: Estudo transversal em familiares de amostra aleatória dos casos-índice identificados por programa de triagem neonatal em Pernambuco, no período de 2001 a 2005. O modelo de triagem familiar ampliado incluiu 463 membros familiares de 21 casos-índice. Os familiares foram categorizados como: núcleo reduzido (NR -pai, mãe e irmãos); de primeiro grau (N1 - avós, tios e primos de primeiro grau); de segundo grau (N2 - filhos dos primos de primeiro grau); ampliado (NA - NR+N1+N2) e ampliado de primeiro grau (NA1 -NR+N1). A confirmação da presença de HBB*S e detecção de hemoglobinas anormais foram realizadas por meio da High Performance Liquid Chromathgraphy. A associação entre a presença de HBB*S e variáveis foi testada pelo cálculo da razão de prevalência e respectivos IC 95% e a diferença entre médias verificadas pelo teste t de Student, ao nível de significância de 5%. RESULTADOS: A anemia falciforme era desconhecida por 81% dos familiares; o gene HBB*S esteve presente em 114 familiares. Observou-se que 53,3% da população estudada estava na faixa considerada reprodutiva e 80% das pessoas portadoras do gene HBB*S já tinham gerado filhos. A freqüência foi maior no núcleo NR (69%), mas também elevada no N1 (22,8%). O NA1 resultou na detecção de 69 portadores adicionais (aumento de 172%). CONCLUSÕES: Os resultados indicam que a triagem familiar para identificação de portadores de síndrome falciforme deve ser estendida para os familiares até o primeiro grau.
Resumo:
O objetivo desta comunicação foi descrever a detecção de coexistência de variantes HIV-1 com inserções de dois aminoácidos entre os códons 69 e 70 da transcriptase reversa. Tais variantes foram isoladas de paciente do sexo masculino, 16 anos de idade, em tratamento no interior do estado de São Paulo. Após confirmação de falha terapêutica, foi realizado teste de resistência a antirretrovirais, a partir do qual foram detectadas duas variantes contendo inserções dos aminoácidos Ser-Gly/Ser-Ala no códon 69 da transcriptase reversa, além da mutação T69S. Tais inserções possuem baixa prevalência, não foram relatadas em caráter de coexistência no Brasil e estão relacionadas com a resistência a múltiplas drogas, tornando o achado relevante do ponto de vista epidemiológico.
Resumo:
Pentamidine (PEN) is an alternative compound to treat antimony-resistant leishmaniasis patients, which cellular target remains unclear. One approach to the identification of prospective targets is to identify genes able to mediate PEN resistance following overexpression. Starting from a genomic library of transfected parasites bearing a multicopy episomal cosmid vector containing wild-type Leishmania major DNA, we isolated one locus capable to render PEN resistance to wild type cells after DNA transfection. In order to map this Leishmania locus, cosmid insert was deleted by two successive sets of partial digestion with restriction enzymes, followed by transfection into wild type cells, overexpression, induction and functional tests in the presence of PEN. To determine the Leishmania gene related to PEN resistance, nucleotide sequencing experiments were done through insertion of the transposon Mariner element of Drosophila melanogaster (mosK) into the deleted insert to work as primer island. Using general molecular techniques, we described here this method that permits a quickly identification of a functional gene facilitating nucleotide sequence experiments from large DNA fragments. Followed experiments revealed the presence of a P-Glycoprotein gene in this locus which role in Leishmania metabolism has now been analyzed.