182 resultados para DNA-PROBE

em Scielo Saúde Pública - SP


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The development of a repetitive DNA probe for Babesia bigemina was reviewed. The original plasmid (p(Bbi)16) contained an insert of B. bigemina DNA of approximately 6.3 kb. This probe has been evaluated for specificityand analytical sensitivity by dot hybridization with isolates from Mexico, the Caribbean region and Kenya. A partial restriction map has been constructed and insert fragments have been subcloned and utilized as specific DNA probes. A comparison of 32P labelled and non-radioactive DNA probes was presented. Non-radioctive detection systems that have been used include digoxigenin dUTP incorporation, and detection by colorimetric substrate methods. Derivatives from the original DNA probe have been utilized to detect B. bigemina infection in a) experimentally inoculated cattle, b) field exposed cattle, c) infected Boophilus microplus ticks, and d) the development of a PCR amplification system.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

An epidemiological survey was conducted in south east Mexico, in an effort to establish the serological reactivity and carrier status to Babesia bigemina of an indigenous cattle population. The prevalance was obtained through the Indirect Fluorescent Antibody Test (IFAT), using an in vitro culture-derived B. bigemina antigen. A specific, digoxigenin-coupled, ~6kb B. bigemina-DNA probe (BBDP), was used to indicate the presence of the parasite. Serum samples from 925 animals of all ages, were obtained within the three regions (I, II, III) of the state of Yucatan and tested by IFAT. In addition, whole blood samples draw from 136 of the same animals of region II were analyzed using the BBDP. Positive IFAT (IFAT+) reactions were observed in 531 sera for a 57% overall prevalence. Regional values were: I = 157 + (56%), II = 266 + (68%) and III = 108 + (42%). Only 32 (23%) of the blood samples tested with BBDP showed distinctive hybridization signal, in contrast with 100 (73%) IFAT + animals. The responses distribution for IFAT vs. BBDP was: +/+ 23, +/- 77, -/+ 9 and -/- 27 respectively. It was found that the analytical sinsitivity of BBDP appears to be low for its utilization is widespread epidemiological surveys. It was considered, however, that the colorimetric probe mifht to be useful to safely detect transmission prone carriers, since it is able to detect parasitemias as low as 0.001%.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Cercarial shedding tests do not provide species identification of the shistosomes concerned and cannot detect prepatent schistosomal infections. We have demonstrated that both immunodetection by ELISA of schistosomal antigens in snail hemophlymph, and dot hybridization of snail extracts by DNA probe representing highly repeated sequences, proved suitable for detecting infected snails during prepatnecy as well as patency. A group-specific monoclonal antibody was found to be suitable for detecting Schistosoma mansoni infection in Biomphalaria sp., but not for positive identification of S. haematobium in Blulinus sp. Comparative evaluation of the diagnostic qualities, and technical aspects and cost of these tests, point to the superiority of the immunodetection approach for large scale detection of snails prepatently infected with S. mansoni. This approach is potentially useful for providing extended information on schistosome-snail epidemiology that may facilitate rapid evaluation of the danger of post-control reinfection, and help make decisions on the time and place of supplementary control measures. In this context the potential usefulness of the immunodetection or DNA probing approach for facilitating catalytic model representation of schistosome-snail epidemiology warrants further evaluation. Specific identification of S. haematobium in Bulinus by either of these approaches may be possible depending on the development of suitable antibodies or DNA probes.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

PURPOSE: Williams-Beuren syndrome is a rare multiple anomalies/mental retardation syndrome caused by deletion of contiguous genes at chromosome region 7q11.23. The aim of this work was to determine the frequency and the types of renal and urinary tract anomalies in 20 patients with Williams-Beuren syndrome. METHODS: The fluorescence in situ hybridization test using a LSI Williams syndrome region DNA probe was performed for all 20 patients to confirm the diagnosis of Williams-Beuren syndrome. A prospective study was performed in order to investigate renal and urinary aspects using laboratory assays to check renal function, ultrasonography of the kidneys and urinary tract, voiding cystourethrogram and urodynamics. RESULTS: Deletion of the elastin gene (positive fluorescence in situ hybridization test) was found in 17 out of 20 patients. Renal alterations were diagnosed in 5 of 17 (29%) the patients with the deletion and in 1 of 3 patients without the deletion. Fourteen patients with the deletion presented dysfunctional voiding. Arterial hypertension was diagnosed in 3 patients with deletions and 1 of these presented bilateral stenosis of the renal arteries. CONCLUSIONS: Due to the high incidence of renal and urinary abnormalities in Williams-Beuren syndrome, performing a systematic laboratory and sonographic evaluation of the patients is recommended.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

To a large extent, control of malaria vectors relies on the elimination of breeding sites and the application of chemical agents. There are increasing problems associated with the use of synthetic insecticides for vector control, including the evolution of resistance, the high cost of developing and registering new insecticides and an awareness of pollution from insecticide residues. These factors have stimulated interest in the application of molecular biology to the study of mosquito vectors of malaria; focussing primarily on two aspects. First, the improvement of existing control measures through the development of simplified DNA probe systems suitable for identification of vectors of malaria. The development of synthetic, non-radioactive DNA probes suitable for identification of species in the Anopheles gambiae complex is described with the aim of defining a simplified methodology wich is suitable for entomologist in the field. The second aspect to be considered is the development of completely novel strategies through the development of completely novel strategies through the genetic manipulation of insect vectors of malaria in order to alter their ability to transmit the disease. The major requirements for producing transgenic mosquitoes are outlined together with the progress wich has been made to date and discussed in relation to the prospects which this type of approach has for the future control of malaria.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The diagnosis of tick-borne diseases such as babesiosis still depends on observing the parasite in the infected erythrocyte. Microscopic observation is tedious and often problematic in both early and carrier infections. Better diagnostic methods are needed to prevent clinical disease, especially when susceptible cattle are being moved into disease enzootic areas. This study evaluates two techniques for early diagnosis of Babesia bovis infections in cattle, DNA probes specific for the organism and fluorescent probes specific nucleic acid. The radioisotopically labeled DNA probes are used in slot blot hybridizations whith lysed blood samples, not purified DNA. Thusfar, the probe is specific for B. bovis and can detect as few as 1000 B. bovis parasites in 10µl of blood. The specificity of the fluorescent probe depends on the characteristic morphology of the babesia in whole blood samples, as determined microscopically. The fluorescent probe detects as afew as 10,000 B. bovis parasites in 10*l as blood. The application of each method for alboratory and field use is discussed.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Accurate diagnosis of Babesia bigemina infection, an economically important tick-transmitted protozoan parasite of cattle, is essential in the management of disease control and in epidemiological studies. The currentlyused methods of diagnosis are blood smear examination and serological tests which include agglutination and immunofluorescence tests. These testes have been used the fild but because they lack sensitivity and specificity, never and improved methods of diagnosis are being developed. The quantitative buffy coat (OBC) method, using microhaematocrit tubes and acridine orange staining allows rapid and quicker diagnosis of B. bigemina and other blood parasites compared to light microscopic examination of stained smears. Parasite specific monoclonal antibodies have been used in antigen/antibody capture enzymelinked immunosorbent assays with grater sensitivity and specificity than previously described serological tests. Similary, DNA probes, derived from a repetitive sequence of the B. bigemina genome, offer a method of detecting very small numbers of parasites which are undetectable by conventional microscopy. An extrachromosomal DNA element, present in all the tick-borne protozoan parasites so far tested, provides an accurate means of diferentiating mixed parasite populations in infected animals. These improved methods will greatly facilitate epidemiological studies.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

A Leishmania donovani-complex specific DNA probe was usedto confirm the widespread dissemination of amastigotes in apparently normal skinof dogs with canine visceral leishmaniasis. When Lutzomyia longipalpis were fed on abnormal skin of five naturally infected dogs 57 of 163 (35 per cent) fliesbecame infected: four of 65 flies (6 per cent) became infected when fed on apparently normal skin. The bite of a single sandfly that had fed seven days previouslyon a naturally infected dog transmitted the infection to a young dog from a non-endemic area. Within 22 days a lesion had developed at the site of the infectivebite (inner ear): 98 days after infection organisms had not disseminated throughout the skin, bone marrow, spleen or liver and the animal was still serologically negative by indirect immunofluorescence and dot-enzyme-linked immunosorbent assay. When fed Lu. longipalpis were captured from a kennel with a sick dog known to be infected, 33 out of 49 (67 per cent) of flies contained promastigotes. In contrast only two infections were detected among more than 200 sandflies captured in houses. These observations confirm the ease of transmissibility of L.chagasi from dog to sandfly to dog in Teresina. It is likely that canine VL is the major source of human VL by the transmission route dog-sandfly-human. the Lmet2 DNA probe was a useful epidemiological tool for detecting L. chagasi in sandflies.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

We review studies from our laboratories using different molecular tools to characterize the ancestry of Brazilians in reference to their Amerindian, European and African roots. Initially we used uniparental DNA markers to investigate the contribution of distinct Y chromosome and mitochondrial DNA lineages to present-day populations. High levels of genetic admixture and strong directional mating between European males and Amerindian and African females were unraveled. We next analyzed different types of biparental autosomal polymorphisms. Especially useful was a set of 40 insertion-deletion polymorphisms (indels) that when studied worldwide proved exquisitely sensitive in discriminating between Amerindians, Europeans and Sub-Saharan Africans. When applied to the study of Brazilians these markers confirmed extensive genomic admixture, but also demonstrated a strong imprint of the massive European immigration wave in the 19th and 20th centuries. The high individual ancestral variability observed suggests that each Brazilian has a singular proportion of Amerindian, European and African ancestries in his mosaic genome. In Brazil, one cannot predict the color of persons from their genomic ancestry nor the opposite. Brazilians should be assessed on a personal basis, as 190 million human beings, and not as members of color groups.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Sequence analysis of Leishmania (Viannia) kDNA minicircles and analysis of multiple sequence alignments of the conserved region (minirepeats) of five distinct minicircles from L. (V.) braziliensis species with corresponding sequences derived from other dermotropic leishmanias indicated the presence of a sub-genus specific sequence. An oligonucleotide bearing this sequence was designed and used as a molecular probe, being able to recognize solely the sub-genus Viannia species in hybridization experiments. A dendrogram reflecting the homologies among the minirepeat sequences was constructed. Sequence clustering was obtained corresponding to the traditional classification based on similarity of biochemical, biological and parasitological characteristics of these Leishmania species, distinguishing the Old World dermotropic leishmanias, the New World dermotropic leishmanias of the sub-genus Leishmania and of the sub-genus Viannia.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Single-stranded DNA (ssDNA) is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse) were used at a 100:1 molar ratio in the presence of double-stranded template DNA. The ssDNA thus produced was suitable for immobilisation as probe onto the surface of an Indium tin oxide electrode and hybridisation in a system for sequence-specific electrochemical detection of W. bancrofti. The hybridisation of the ssDNA probe and target ssDNA led to considerable decreases in both the anodic and the cathodic currents of the system's redox couple compared with the unhybridised DNA and could be detected via cyclic voltammetry. This method is reproducible and avoids many of the difficulties encountered by conventional methods of filarial parasite DNA detection; thus, it has potential in xenomonitoring.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The G genotyping of 74 group A rotavirus samples was done by RNA-DNA hybridization (dot-blot) using oligonucleotide probes for the VP7 gene region of the human rotavirus serotypes/genotypes 1, 2, 3 and 4. Thirty-one samples could be genotyped by dot-blot showing the following results: G1 = 16, G4 = 6, G3 = 5, and G2 = 4. The data show circulation of genotypes G1-G4 and the predominance of G1. The knowledge of genotypes provides important information concerning rotavirus circulation in Central Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Foi realizado diagnóstico para leishmaniose tegumentar americana a partir de sangue de pacientes residentes em dois municípios endêmicos do estado de Pernambuco. O DNA de 119 amostras de sangue foi extraído e submetido a reação em cadeia da polimerase. Utilizaram-se primers do minicírculo do DNA do cinetoplasto (kDNA) de Leishmania braziliensis, circulante em Pernambuco, cuja seqüência-alvo gera um fragmento de 750 pares de bases. No total 58 (48,7%) indivíduos apresentaram amplificação positiva e 61 (51,3%) negativa. Das amostras positivas para a PCR, 37 (≅ 64%) pertenciam a indivíduos tratados e sem lesão. Conclui-se que a técnica de PCR é eficaz para identificar o DNA de leishmânia em material de biópsias e em sangue venoso.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The detection of HBV-DNA in serum by molecular hybridization is the most sensitive and specific marker of replication and infectivity of hepatitis B virus and currently is proposed as a routine diagnostic technique in the follow-up of HBV - related diseases. Comparing different techniques already described, we found that direct spotting of serum samples on nitrocellulose membranes under vacuum filtration, followed by denaturing and neutralizing washes is more practical, simple, sensible and reproducible. DNA polymerase assay using phosphonoformic acid as specific viral inhibitor has shown 86.8% of concordance with HBV-DNA detection, and so, it is an useful alternative in the follow-up of hepatitis B chronic patients. We found 19.2% HBeAg positive samples with no other markers of viral replication and no anti-HBe positive sample had detectable HBV-DNA. Discordance between the 2 systems have been extensively described, and we confirm this for the first time in our country. Molecular biological techniques are essential to determine the replication status of chronic hepatitis B patients.