19 resultados para DNA structure
em Scielo Saúde Pública - SP
Resumo:
Anopheles darlingi is the most important Brazilian malaria vector, with a widespread distribution in the Amazon forest. Effective strategies for vector control could be better developed through knowledge of its genetic structure and gene flow among populations, to assess the vector diversity and competence in transmitting Plasmodium. The aim of this study was to assess the genetic diversity of An. darlingi collected at four locations in Porto Velho, by sequencing a fragment of the ND4 mitochondrial gene. From 218 individual mosquitoes, we obtained 20 different haplotypes with a diversity index of 0.756, equivalent to that found in other neotropical anophelines. The analysis did not demonstrate significant population structure. However, haplotype diversity within some populations seems to be over-represented, suggesting the presence of sub-populations, but the presence of highly represented haplotypes complicates this analysis. There was no clear correlation among genetic and geographical distance and there were differences in relation to seasonality, which is important for malarial epidemiology.
Resumo:
Previous studies of subtelomeric regions in Plasmodium berghei led to the identification of subtelomeric repeats (2.3kb long) present in a variable number at many chromosomal ends. Both loss and increase in 2.3kb-repeat copy number are involved in chromosome-size polymorphisms. Subtelomeric losses leading to chromosome-size polymorphisms have been described by several authors in P.falciparum where the structure of subtelomeric regions is not known in detail. We therefore undertook their characterisation, by means of chromosome walking and jumping techniques, starting from the telomere-flanking sequence present in pPftel.1, the P.falciparum telomeric clone described by Vernick and McCutchan (1988). The results indicate that at least 20 (out of 28) chromosomal ends in P.falciparum 3D7 chromosomes share a subtelomeric region, about 40kb long, covering (but not limited to) the Rep20 region. Non repetitive, AT-rich portions flanking the Rep20 region on both sides are also conserved at most chromosomal ends.
Resumo:
DNA sequence comparison of 412 base-pairs fragments of the mitochondrial cytochrome B gene was used to infer the genetic structure of nine geographical Triatoma infestans populations and their phylogenetic relationship with T. melanosoma and T. brasiliensis. T. infestans and T. melanosoma were compared by morphometry, allozyme and cytogenetic analyses, as well as subjected to reciprocal crosses, in order to clarify the taxonomic status of the latter. No differences were found to distinguish the two species and the crosses between them yielded progeny. T. infestans populations presented four haplotypes that could be separated in two clusters: one formed by the samples from Bolivia (Andes and Chaco) and the other formed by samples from Argentina and Brazil. Silvatic and domestic T. infestans populations from Bolivia (Andes) were genetically identical.
Resumo:
To establish the relationships of the lizard- and mammal-infecting Leishmania, we characterized the intergenic spacer region of ribosomal RNA genes from L. tarentolae and L. hoogstraali. The organization of these regions is similar to those of other eukaryotes. The intergenic spacer region was approximately 4 kb in L. tarentolae and 5.5 kb in L. hoogstraali. The size difference was due to a greater number of 63-bp repetitive elements in the latter species. This region also contained another element, repeated twice, that had an inverted octanucleotide with the potential to form a stem-loop structure that could be involved in transcription termination or processing events. The ribosomal RNA gene localization showed a distinct pattern with one chromosomal band (2.2 Mb) for L. tarentolae and two (1.5 and 1.3 Mb) for L. hoogstraali. The study also showed sequence differences in the external transcribed region that could be used to distinguish lizard Leishmania from the mammalian Leishmania. The intergenic spacer region structure features found among Leishmania species indicated that lizard and mammalian Leishmania are closely related and support the inclusion of lizard-infecting species into the subgenus Sauroleishmania proposed by Saf'janova in 1982.
Resumo:
American trypanosomiasis is a common zoonosis in Colombia and Trypanosoma cruzi presents a wide distribution throughout the country. Although some studies based on enzyme electrophoresis profiles have described the population structure of the parasite, very few molecular analyses of genotipic markers have been conducted using Colombian strains. In this study, we amplified the non-transcribed spacer of the mini-gene by PCR, typing the isolates as T. cruzi I, T. cruzi zymodeme 3 or T. rangeli. In addition, the internal transcribed spacers of the ribosomal gene concomitant with the 5.8S rDNA were amplified and submitted to restriction fragment polymorphism analysis. The profiles were analyzed by a numerical methodology generating a phenetic dendrogram that shows heterogeneity among the T. cruzi isolates. This finding suggests a relationship between the complexity of the sylvatic transmission cycle in Colombia and the diversity of the sylvan parasites.
Resumo:
A total of 106 women with vaginitis in Nicaragua were studied. The positive rate for the identification of Candida species was 41% (44 positive cultures out of 106 women with vaginitis). The sensitivity of microscopic examination of wet mount with the potassium hydroxide (KOH) was 61% and 70% with Gram's stain when using the culture of vaginal fluid as gold standard for diagnosis of candidiasis. Among the 44 positives cultures, isolated species of yeast from vaginal swabs were C. albicans (59%), C. tropicalis (23%), C. glabrata (14%) and C. krusei (4%). This study reports the first characterization of 26 C. albicans stocks from Nicaragua by the random amplified polymorphic DNA method. The genetic analysis in this small C. albicans population showed the existence of linkage disequilibrium, which is consistent with the hypothesis that C. albicans undergoes a clonal propagation.
Resumo:
Random amplified polymorphic DNA (RAPD) markers were used to analyze 119 DNA samples of three Colombian Anopheles nuneztovari populations to study genetic variation and structure. Genetic diversity, estimated from heterozygosity, averaged 0.34. Genetic flow was greater between the two populations located in Western Colombia (F ST: 0.035; Nm: 6.8) but lower between these two and the northeastern population (F ST: 0.08; Nm: 2.8). According to molecular variance analysis, the genetic distance between populations was significant (phiST 0.1131, P < 0.001). The variation among individuals within populations (phiST 0.8869, P < 0.001)was also significant, suggesting a greater degree of population subdivision, not considered in this study. Both the parameters evaluated and the genetic flow suggest that Colombian An. nuneztovari populations are co-specific.
Resumo:
Triatoma venosa presents a restricted geographical distribution in America and is considered as a secondary vector of Chagas disease in Colombia and Ecuador. A total of 120 adult insects were collected in domestic and peridomestic habitats in an endemic area of the department of Boyacá, Colombia, in order to determine their genetic structure through morphometric and molecular techniques. The head and wings of each specimen were used for the analyses of size, shape, and sexual dimorphism. A significant sexual dimorphism was found, although no differences in size among the studied groups were detected. Differences were found in the analyzed structures except for male heads. DNA was extracted from the legs in order to carry out the internal transcriber space-2 (ITS-2) amplification and the randon amplified polymorphic DNA (RAPD) analyses. Length polymorphisms were not detected in the ITS-2. Fst and Nm values were estimated (0.047 and 3.4, respectively). The high genetic flow found among the insects captured in the domicile and peridomiciliary environment does not permit a genetic differentiation, thus establishing the peridomicile as an important place for epidemiological surveillance.
Resumo:
The genetic variation and population structure of three populations of Anopheles darlingi from Colombia were studied using random amplified polymorphic markers (RAPDs) and amplified fragment length polymorphism markers (AFLPs). Six RAPD primers produced 46 polymorphic fragments, while two AFLP primer combinations produced 197 polymorphic fragments from 71 DNA samples. Both of the evaluated genetic markers showed the presence of gene flow, suggesting that Colombian An. darlingi populations are in panmixia. Average genetic diversity, estimated from observed heterozygosity, was 0.374 (RAPD) and 0.309 (AFLP). RAPD and AFLP markers showed little evidence of geographic separation between eastern and western populations; however, the F ST values showed high gene flow between the two western populations (RAPD: F ST = 0.029; Nm: 8.5; AFLP: F ST = 0.051; Nm: 4.7). According to molecular variance analysis (AMOVA), the genetic distance between populations was significant (RAPD:phiST = 0.084; AFLP:phiST = 0.229, P < 0.001). The F ST distances and AMOVAs using AFLP loci support the differentiation of the Guyana biogeographic province population from those of the Chocó-Magdalena. In this last region, Chocó and Córdoba populations showed the highest genetic flow.
Resumo:
Lymphatic filarial (LF) parasites have been under anti-filarial drug pressure for more than half a century. Currently, annual mass drug administration (MDA) of diethylcarbamazine (DEC) or ivermectin in combination with albendazole (ALB) have been used globally to eliminate LF. Long-term chemotherapies exert significant pressure on the genetic structure of parasitic populations. We investigated the genetic variation among 210 Wuchereria bancrofti populations that were under three different chemotherapy strategies, namely MDA with DEC alone (group I, n = 74), MDA with DEC and ALB (group II, n = 60) and selective therapy (ST) with DEC (group III, n = 34) to understand the impact of these three drug regimens on the parasite genetic structure. Randomly amplified polymorphic DNA profiles were generated for the three groups of parasite populations; the gene diversity, gene flow and genetic distance values were determined and phylogenetic trees were constructed. Analysis of these parameters indicated that parasite populations under ST with a standard dose of DEC (group III) were genetically more diverse (0.2660) than parasite populations under MDA with DEC alone (group I, H = 0.2197) or with DEC + ALB (group II, H = 0.2317). These results indicate that the MDA may reduce the genetic diversity of W. bancrofti populations when compared to the genetic diversity of parasite populations under ST.
Resumo:
Triatoma sordida is a species that transmits Trypanosoma cruzi to humans. In Brazil, T. sordida currently deserves special attention because of its wide distribution, tendency to invade domestic environments and vectorial competence. For the planning and execution of control protocols to be effective against Triatominae, they must consider its population structure. In this context, this study aimed to characterise the genetic variability of T. sordida populations collected in areas with persistent infestations from Minas Gerais, Brazil. Levels of genetic variation and population structure were determined in peridomestic T. sordida by sequencing a polymorphic region of the mitochondrial cytochrome b gene. Low nucleotide and haplotype diversity were observed for all 14 sampled areas; π values ranged from 0.002-0.006. Most obtained haplotypes occurred at low frequencies, and some were exclusive to only one of the studied populations. Interpopulation genetic diversity analysis revealed strong genetic structuring. Furthermore, the genetic variability of Brazilian populations is small compared to that of Argentinean and Bolivian specimens. The possible factors related to the reduced genetic variability and strong genetic structuring obtained for studied populations are discussed in this paper.
Resumo:
Genetic structure of populations of Pissodes castaneus (De Geer) (Coleoptera, Curculionidae) using amplified fragment length polymorphism. The objective of this study was to determine the genetic structure of populations of Pissodes castaneus from different areas and on different species of Pinus using the PCR-AFLP technique. Twenty samples were analyzed, representing 19 populations from Brazil and one from Florence, Italy, which is the region of origin of P. castaneus. The four combinations of primers generated a total of 367 fragments of DNA, and 100% of polymorphic loci, indicating high degree of molecular polymorphism. The dendrogram did not reveal trends for grouping the populations in relation to origin. The low genetic similarity (0.11 between the most distant groups) and genetic distances of 0.13 and 0.44 for 10 out of the 20 samples may indicate several founding events or multiple introductions of heterogeneous strains into Brazil. The allelic fixation index (Fst) was 0.3851, considered high, and the number of migrants (Nm) was 0.3991, indicating low gene flow among populations. The highest genetic distances were between the population from Irani, SC and Cambará do Sul, RS and Bituruna, PR, indicating an independent founding event or a particular allelic fixation in the former location. The high genetic diversity among populations points out that the populations are genetically heterogeneous with a diverse gene pool in the surveyed areas, what makes them to respond differently to control measures.
Resumo:
The study of the ecology of soil microbial communities at relevant spatial scales is primordial in the wide Amazon region due to the current land use changes. In this study, the diversity of the Archaea domain (community structure) and ammonia-oxidizing Archaea (richness and community composition) were investigated using molecular biology-based techniques in different land-use systems in western Amazonia, Brazil. Soil samples were collected in two periods with high precipitation (March 2008 and January 2009) from Inceptisols under primary tropical rainforest, secondary forest (5-20 year old), agricultural systems of indigenous people and cattle pasture. Denaturing gradient gel electrophoresis of polymerase chain reaction-amplified DNA (PCR-DGGE) using the 16S rRNA gene as a biomarker showed that archaeal community structures in crops and pasture soils are different from those in primary forest soil, which is more similar to the community structure in secondary forest soil. Sequence analysis of excised DGGE bands indicated the presence of crenarchaeal and euryarchaeal organisms. Based on clone library analysis of the gene coding the subunit of the enzyme ammonia monooxygenase (amoA) of Archaea (306 sequences), the Shannon-Wiener function and Simpson's index showed a greater ammonia-oxidizing archaeal diversity in primary forest soils (H' = 2.1486; D = 0.1366), followed by a lower diversity in soils under pasture (H' = 1.9629; D = 0.1715), crops (H' = 1.4613; D = 0.3309) and secondary forest (H' = 0.8633; D = 0.5405). All cloned inserts were similar to the Crenarchaeota amoA gene clones (identity > 95 %) previously found in soils and sediments and distributed primarily in three major phylogenetic clusters. The findings indicate that agricultural systems of indigenous people and cattle pasture affect the archaeal community structure and diversity of ammonia-oxidizing Archaea in western Amazon soils.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
This study was carried out to assess the genetic variability of ten "cagaita" tree (Eugenia dysenterica) populations in Southeastern Goiás. Fifty-four randomly amplified polymorphic DNA (RAPD) loci were used to characterize the population genetic variability, using the analysis of molecular variance (AMOVA). A phiST value of 0.2703 was obtained, showing that 27.03% and 72.97% of the genetic variability is present among and within populations, respectively. The Pearson correlation coefficient (r) among the genetic distances matrix (1 - Jaccard similarity index) and the geographic distances were estimated, and a strong positive correlation was detected. Results suggest that these populations are differentiating through a stochastic process, with restricted and geographic distribution dependent gene flow.