The p53 gene expression and its developmental regulation in schistosomes

We have studied the gene expression, especially of the oncoproteins, and its regulation in schistosomes. Schistosomes have a complex life cycle with defined dimorphic lifestyle. The parasite are so far unique in biology in expressing oncogene products in their adult stage. In order to characterize the expression and developmental regulation, a lambda gt 11 cDNA library and lambda EMBL4 genomic DNA library of each growth stage of Schistosoma mansoni and S. japonicum was constructed, and was screened with various monoclonal antibodies against ongogene products. One positive plaque reacted to anti-p53 antibody (Ab-2, Oncogene Science, Inc.) was further analyzed. This fusion protein was about 120 KDa in molecular weights, and expressed as 1.4 Kb RNA in the adult stage. P53 gene is well-known as the negative regulator of the cell cicle, and the mutations in the gene are turning out to be the most common genetic alterations in human cancers. The comparison of the gene structure among species and stages were being conducted. Chromosome structures, C-band formation, and the results of in situ hybridization using the phage probe would be discussed.

Plasmodium yoelii: identification of a gene encoding a putative ADP-ribosylation factor-1 GTPase-activating Protein, PyAG1

The PyAG1 gene, identified by the screening of a Plasmodium yoelii genomic DNA library with a rhoptry-specific Mab, encodes a protein with a zinc finger structure immediately followed by the consensus sequence of the Arf GAP catalytic site. The serum of mice immunized with the recombinant protein recognized specifically the rhoptries of the late infected erythrocytic stages. Blast analysis using the Genbank database gave the highest scores with four proteins presenting an Arf1 GAP activity. If presenting also this activity, the PyAG1 protein could be involved in the regulation of the secreted protein vesicular transport and, consequently, in the rhoptry biogenesis.

Characterization of a clone from an adult worm cDNA library selected with anti-Schistosoma mansoni human antibodies dissociated from immune complexes: a preliminary report

Considering the scarcity of defined antigens, actually useful and reliable for use in the field studies, we propose an alternative method for selection of cDNA clones with potential use in the diagnosis of schistosomiasis. Human antibodies specific to a protein fraction of 31/32 kDa (Sm31/32), dissociated from immune complexes, are used for screening of clones from an adult worm cDNA library. Partial sequencing of five clones, selected through this strategy, showed to be related to Schistosoma mansoni: two were identified as homologous to heat shock protein 70, one to glutathione S-transferase, one to homeodomain protein, and one to a previously described EST (expressed sequence tag) of S. mansoni. This last clone was the most consistently reactive during the screening process with the anti-Sm31/32 antibodies dissociated from the immune complexes. The complete sequence of this clone was obtained and the translation data yielded only one ORF (open reading frame) that code for a protein with 57 amino acids. Based on this amino acid sequence two peptides were chemically synthesized and evaluated separately against a pool of serum samples from schistosomiasis patients and non-schistosomiasis individuals. Both peptides showed strong reactivity only against the positive pool, suggesting that these peptides may be useful as antigens for the diagnosis of schistosomiasis mansoni.

DNA probes for distinguishing Psychodopygus wellcomei from Psychodopygus complexus (Diptera: Psychodidae)

Genomic DNA fragments from males of Psychodopygus wellcomei were isolated and shown to be useful as sensitive diagnostic probles for positively separting individuals of this species from those of Ps. complexus. These two members of the Ps. squamiventris series are found sympatrically in foci of cutaneous leishmaniasis in the hill forests of southern Pará State. Of the two species, only Ps. welcomei is thought to be an important vector of Leishmania braziliensis sensu stricto, buth this is based on circumstantial evidence because of the difficulties of identifying female sandflies wothin the series. The diagnostic probes were isolated from a library of Ps. wellcomei built by ligationg short fragments of Sau 3A-resistricted, genomic DNA into the plasmid vector PUC 18. Differential screening of 1316 library clones with total genomic DNA of Ps. Wellcomei and Ps. complexus identified 5 recombinants, with cross-hybridizing inserts of repetitive DNA, that showed strong specificity for Ps. wellcomei. As little as 0.4% of the DNA extracted from an individual sandfly (=ca. 0.5 namograms) was specifically detected. The diagnostic probes were used to identify as Ps. wellcomei a wild-caught female sandfly found infected with L. braziliensis s.s., providing only the second positive association between these two species.

A new repetitive DNA sequence from Trypanosoma cruzi

Tandemly repeated DNA sequences are found in the genome of higher eukaryotes, and have also been demonstrated in Trypanosoma cruzi. Repeated DNA sequences are potentially useful for the diagnostic detection of T. cruzi (A. Gonzales et al., 1984, Proc. Natl. Acad. Sci. USA, 81: 3356-3360). We have isoleted two clones from a genomic library of T. cruzi (Y strain) that contain, in one clone a family of at least seven copies of a repetitive sequence of approximately 600 base pairs, and in the other an independent copy of the same sequence. One copy of the repetition (HSP) and the independent clone (HCR) were sequenced by the Sanger procedure (Fig.). This sequence hybridized to four strains of T. cruzi tested and did not hybridize to eleven species of trypanosotids from five different Genera, being a good candidate for diagnostic assays. GenBank accession numbers: HSP#m31919, HCR#31920.

Sequencing and identification of expressed Schistosoma mansoni genes by random selection of cDNA clones from a directional library

We have initiated a gene discovery program in Schistosoma mansoni based on the technique of Expressed Sequence Tags (ESTs), i.e. partial sequences of cDNAs obtained from single passes in automatic DNA sequencers. ESTs can be used to identify genese onf the basis of their homology whith sequences from other species deposited in DNA or protein databases. Trasncripts with sequences without matches in teh databases may represent novel parasite-specific genes. This approach has shown to be very efficient and in less than two years a broad range of novel genes has already been ascertained, more than doubling the number of known S. mansoni genes.

A bacterial artificial chromosome library for Biomphalaria glabrata, intermediate snail host of Schistosoma mansoni

To provide a novel resource for analysis of the genome of Biomphalaria glabrata, members of the international Biomphalaria glabrata Genome Initiative (biology.unm.edu/biomphalaria-genome.html), working with the Arizona Genomics Institute (AGI) and supported by the National Human Genome Research Institute (NHGRI), produced a high quality bacterial artificial chromosome (BAC) library. The BB02 strain B. glabrata, a field isolate (Belo Horizonte, Minas Gerais, Brasil) that is susceptible to several strains of Schistosoma mansoni, was selfed for two generations to reduce haplotype diversity in the offspring. High molecular weight DNA was isolated from ovotestes of 40 snails, partially digested with HindIII, and ligated into pAGIBAC1 vector. The resulting B. glabrata BAC library (BG_BBa) consists of 61824 clones (136.3 kb average insert size) and provides 9.05 × coverage of the 931 Mb genome. Probing with single/low copy number genes from B. glabrata and fingerprinting of selected BAC clones indicated that the BAC library sufficiently represents the gene complement. BAC end sequence data (514 reads, 299860 nt) indicated that the genome of B. glabrata contains ~ 63% AT, and disclosed several novel genes, transposable elements, and groups of high frequency sequence elements. This BG_BBa BAC library, available from AGI at cost to the research community, gains in relevance because BB02 strain B. glabrata is targeted whole genome sequencing by NHGRI.

Prey identification in nests of the potter wasp Hypodynerus andeus (Packard) (Hymenoptera, Vespidae, Eumeninae) using DNA barcodes

Prey identification in nests of the potter wasp Hypodynerus andeus (Packard) (Hymenoptera, Vespidae, Eumeninae) using DNA barcodes. Geometrid larvae are the only prey known for larvae of the Neotropical potter wasp Hypodynerus andeus (Packard, 1869) (Hymenoptera, Vespidae, Eumeninae) in the coastal valleys of the northern Chilean Atacama Desert. A fragment of the mitochondrial gene cytochrome oxidase c subunit 1 was amplified from geometrid larvae collected from cells of H. andeus in the Azapa Valley, Arica Province, and used to provide taxonomic identifications. Two species, Iridopsis hausmanni Vargas, 2007 and Macaria mirthae Vargas, Parra & Hausmann, 2005 were identified, while three others could be identified only at higher taxonomic levels, because the barcode reference library of geometrid moths is still incomplete for northern Chile.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

A microsatellite library for Carica papaya L. cv. Sunrise solo

In experimental areas of the Education and Researches Ilha Solteira and Jaboticabal UNESP/Campus farms were selected and tagged 20 hermaphrodite plants and 20 feminine of cultivar Sunrise Solo, Improved Sunrise Solo cv.72/12 and Baixinho of Santa Amália.The seeds origined of the selected fruits were cropped to be analysed the self-pollination efficiency and frequency of the sex in the progenies. After that, samples of the young leaf of the matrix plants were colected for the extration of the DNA. It was built five library enriched of microsatellite sequencies, using probes (TCA)10, (TC)13, (GATA)4, (CAC)10 e (TGAG)8.It was possible the development of the primers only in the library that has utilized the probe (TCA)10. This probe allowed the design of 32 primer pairs. From these, 31 presented pattern of unique band in agarose Metaphor and in acrilamide. For primer S36 were observed 2 bands, but with no polymorphism to differentiation in the sexual form at papaya tree culture. However, these primers can be tested, in the futures, in the investigation of the others features in segregated populations of this specie and the related species, germoplasm analysis, cultivars identification, parent evolution and molecular markers for the assisted plant breeding programs.

Detecção de DNA de Leishmania braziliensis em pacientes de leishmaniose tegumentar americana

Foi realizado diagnóstico para leishmaniose tegumentar americana a partir de sangue de pacientes residentes em dois municípios endêmicos do estado de Pernambuco. O DNA de 119 amostras de sangue foi extraído e submetido a reação em cadeia da polimerase. Utilizaram-se primers do minicírculo do DNA do cinetoplasto (kDNA) de Leishmania braziliensis, circulante em Pernambuco, cuja seqüência-alvo gera um fragmento de 750 pares de bases. No total 58 (48,7%) indivíduos apresentaram amplificação positiva e 61 (51,3%) negativa. Das amostras positivas para a PCR, 37 (≅ 64%) pertenciam a indivíduos tratados e sem lesão. Conclui-se que a técnica de PCR é eficaz para identificar o DNA de leishmânia em material de biópsias e em sangue venoso.

Comparison of serum hepatitis B virus replication markers in patients with chronic hepatitis B: studies on HBeAg/Anti-HBe system, viral dna polymerase and HBV-DNA

The detection of HBV-DNA in serum by molecular hybridization is the most sensitive and specific marker of replication and infectivity of hepatitis B virus and currently is proposed as a routine diagnostic technique in the follow-up of HBV - related diseases. Comparing different techniques already described, we found that direct spotting of serum samples on nitrocellulose membranes under vacuum filtration, followed by denaturing and neutralizing washes is more practical, simple, sensible and reproducible. DNA polymerase assay using phosphonoformic acid as specific viral inhibitor has shown 86.8% of concordance with HBV-DNA detection, and so, it is an useful alternative in the follow-up of hepatitis B chronic patients. We found 19.2% HBeAg positive samples with no other markers of viral replication and no anti-HBe positive sample had detectable HBV-DNA. Discordance between the 2 systems have been extensively described, and we confirm this for the first time in our country. Molecular biological techniques are essential to determine the replication status of chronic hepatitis B patients.

Potential infectivity of blood from HBsAG asymptomatic carriers due to the presence of HBV-DNA and comparison with other markers of hbv infection

Serum samples from 356 HBsAg positive asymptomatic carriers, which were titrated by reverse passive hemagglutination, were analysed for the presence of HBV-DNA, HBsAg and IgM anti-HBc. The samples were divided in three classes, according to the titers of HBsAg and IgM anti-HBc and the distribution of HBV-DNA and HBsAg among these classes was studied. In the high titer class of HBsAg, 65% of samples have one or both markers against only 19% in the low titer class. From the total of 356 samples, 121 gave positive results for IgM anti-HBc (33.9%). From these, 38.9% of HBV-DNA and 47.9% of HBeAg were observed, whereas in samples with absence of IgM anti-HBc, 18.3% and 16.6% were respectively found. A higher frequency of agreement between all these markers was found in the class of high titers of HBsAg; however, HBV-DNA was detected in the low titer class of HBsAg and little or no IgM anti-HBc, showing potential blood infectivity even in HBsAg positive borderline samples.

Human papillomavirus detection in cervical dysplasias or neoplasias and in condylomata acuminaata by in situ hybridization with biotinylated DNA probes

Specimens from cervical dysplasias or carcinomas and genital condylomata acuminata were retrospectively analysed by in situ hybridization (ISH) with bioti-nylated DNA probes for human papillomavirus (HPV) types 6, 11, 16 and 18. In the control group no case was positive for HPV DNA. In mild/moderate dysplasias, 4 cases (14%) were positive for HPV 6 or 11 and 2 cases (7%), for HPV 16. In the severe dysplasia/in situ carcinoma group, 9 cases (31%) showed presence of DNA of HPV types 16 or 18. Six invasive carcinomas (20%) were positive for HPV type 16 or 18. Among condylomata acuminata, 22 cases (73%) were positive for HPV types 6 or 11. In all ISH-positive cases only one viral type was detected. No correlation between HPV DNA positivity and histological findings of HPV infection was observed. Although less sensitive than some other molecular biology techniques, in situ hybridization with biotinylated DNA probes proved to be simple and useful for detecting and typing HPV in samples routinely received for histopathological analysis.