67 resultados para DNA Sequences
em Scielo Saúde Pública - SP
Resumo:
Extensive chromosome size polymorphism in Plasmodium berghei in vivo mitotic multiplication. Size differences between homologous chromosomes mainly involve rearrangements in the subtelomeric regions while internal chromosomal regions are more conserved. Size differences are almost exclusively due to differences in the copy number of a 2.3 kb subtelomeric repeat unit. Not only deletion of 2.3 kb repeats occurs, but addition of new copies of this repeat sometimes results in the formation of enlarged chromosomes. Even chromosomes which originally lack 2.3 kb repeats, can acquire these during mitotic multiplication. In one karyotype mutant, 2.3 kb repeats were inserted within one of the original telomeres of chromosome 4, creating an internal stretch oftelomeric repeats. Chromosome translocation can contribute to chromosome size polymorphism as well We found a karyotype mutant in which chromosome 7 with a size of about 1.4 Mb is translocated to chromosome 13/14 with a size of about 3 Mb, resulting in a rearranged chromosome, which was shown to contain a junction between internal DNA sequences of chromosome 13/14 and subtelomeric 2.3 kb repeats of chromosome 7. In this mutant a new chromosome of 1.4 Mb is present which consists of part of chromosome 13/14.
Resumo:
Cercarial shedding tests do not provide species identification of the shistosomes concerned and cannot detect prepatent schistosomal infections. We have demonstrated that both immunodetection by ELISA of schistosomal antigens in snail hemophlymph, and dot hybridization of snail extracts by DNA probe representing highly repeated sequences, proved suitable for detecting infected snails during prepatnecy as well as patency. A group-specific monoclonal antibody was found to be suitable for detecting Schistosoma mansoni infection in Biomphalaria sp., but not for positive identification of S. haematobium in Blulinus sp. Comparative evaluation of the diagnostic qualities, and technical aspects and cost of these tests, point to the superiority of the immunodetection approach for large scale detection of snails prepatently infected with S. mansoni. This approach is potentially useful for providing extended information on schistosome-snail epidemiology that may facilitate rapid evaluation of the danger of post-control reinfection, and help make decisions on the time and place of supplementary control measures. In this context the potential usefulness of the immunodetection or DNA probing approach for facilitating catalytic model representation of schistosome-snail epidemiology warrants further evaluation. Specific identification of S. haematobium in Bulinus by either of these approaches may be possible depending on the development of suitable antibodies or DNA probes.
Resumo:
Since 1984, Anopheles (Kerteszia) lepidotus has been considered a mosquito species that is involved in the transmission of malaria in Colombia, after having been incriminated as such with epidemiological evidence from a malaria outbreak in Cunday-Villarrica, Tolima. Subsequent morphological analyses of females captured in the same place and at the time of the outbreak showed that the species responsible for the transmission was not An. lepidotus, but rather Anopheles pholidotus. However, the associated morphological stages and DNA sequences of An. pholidotus from the foci of Cunday-Villarrica had not been analysed. Using samples that were caught recently from the outbreak region, the purpose of this study was to provide updated and additional information by analysing the morphology of female mosquitoes, the genitalia of male mosquitoes and fourth instar larvae of An. pholidotus, which was confirmed with DNA sequences of cytochrome oxidase I and rDNA internal transcribed spacer. A total of 1,596 adult females were collected in addition to 37 larval collections in bromeliads. Furthermore, 141 adult females, which were captured from the same area in the years 1981-1982, were analysed morphologically. Ninety-five DNA sequences were analysed for this study. Morphological and molecular analyses showed that the species present in this region corresponds to An. pholidotus. Given the absence of An. lepidotus, even in recent years, we consider that the species of mosquitoes that was previously incriminated as the malaria vector during the outbreak was indeed An. pholidotus, thus ending the controversy.
Resumo:
Tandemly repeated DNA sequences are found in the genome of higher eukaryotes, and have also been demonstrated in Trypanosoma cruzi. Repeated DNA sequences are potentially useful for the diagnostic detection of T. cruzi (A. Gonzales et al., 1984, Proc. Natl. Acad. Sci. USA, 81: 3356-3360). We have isoleted two clones from a genomic library of T. cruzi (Y strain) that contain, in one clone a family of at least seven copies of a repetitive sequence of approximately 600 base pairs, and in the other an independent copy of the same sequence. One copy of the repetition (HSP) and the independent clone (HCR) were sequenced by the Sanger procedure (Fig.). This sequence hybridized to four strains of T. cruzi tested and did not hybridize to eleven species of trypanosotids from five different Genera, being a good candidate for diagnostic assays. GenBank accession numbers: HSP#m31919, HCR#31920.
Resumo:
A hundred-sixty paraffin-embedded specimens from female cervical lesions were examined for human papillomavirus (HPV) types 6, 11, 16 and 18 infections by non-isotopic in situ hybridization. The data were compared with histologic diagnosis. Eighty-eight (55) biopsies contained HPV DNA sequences. In low grade cervical intraepithelial neoplasias (CIN I), HPV infection was detected in 78.7 of the cases, the benign HPV 6 was the most prevalent type. HPV DNA was detected in 58 of CIN II and CIN III cases and in 41.8 of squamous cell carcinomas (SCC). Histologically normal women presented 20 of HPV infection. Oncogenic HPV was found in 10 of these cases, what may indicate a higher risk of developing CINs and cancer. Twenty-five percent of the infected tissues contained mixed infections. HPV 16 was the most common type infecting the cervix and its prevalence raised significantly with the severity of the lesions, pointing its role in cancer pathogenesis. White women presented twice the cervical lesions of mulatto and African origin women, although HPV infection rates were nearly the same for the three groups (approximately 50). Our results showed that HPV typing by in situ hybridization is a useful tool for distinguishing between low and high risk cervical lesions. Further studies are required to elucidate risk factors associated with HPV infection and progression to malignancy in Brazilian population.
Resumo:
The use of in situ techniques to detect DNA and RNA sequences has proven to be an invaluable technique with paraffin-embedded tissue. Advances in non-radioactive detection systems have further made these procedures shorter and safer. We report the detection of Trypanosoma cruzi, the causative agent of Chagas disease, via indirect and direct in situ polymerace chain reaction within paraffin-embedded murine cardiac tissue sections. The presence of three T. cruzi specific DNA sequences were evaluated: a 122 base pair (bp) sequence localized within the minicircle network, a 188 bp satellite nuclear repetitive sequence and a 177 bp sequence that codes for a flagellar protein. In situ hybridization alone was sensitive enough to detect all three T. cruzi specific DNA sequences.
Resumo:
Among the molecular markers commonly used for mosquito taxonomy, the internal transcribed spacer 2 (ITS2) of the ribosomal DNA is useful for distinguishing among closely-related species. Here we review 178 GenBank accession numbers matching ITS2 sequences of Latin American anophelines. Among those, we found 105 unique sequences corresponding to 35 species. Overall the ITS2 sequences distinguish anopheline species, however, information on intraspecific and geographic variations is scarce. Intraspecific variations ranged from 0.2% to 19% and our analysis indicates that misidentification and/or sequencing errors could be responsible for some of the high values of divergence. Research in Latin American malaria vector taxonomy profited from molecular data provided by single or few field capture mosquitoes. However we propose that caution should be taken and minimum requirements considered in the design of additional studies. Future studies in this field should consider that: (1) voucher specimens, assigned to the DNA sequences, need to be deposited in collections, (2) intraspecific variations should be thoroughly evaluated, (3) ITS2 and other molecular markers, considered as a group, will provide more reliable information, (4) biological data about vector populations are missing and should be prioritized, (5) the molecular markers are most powerful when coupled with traditional taxonomic tools.
Resumo:
Members of the Herpesviridae family have been implicated in a number of tumours in humans. At least 75% of the human population has had contact with cytomegalovirus (HCMV). In this work, we screened 75 Brazilian glioma biopsies for the presence of HCMV DNA sequences. HCMV DNA was detected in 36% (27/75) of the biopsies. It is possible that HCMV could be a co-factor in the evolution of brain tumours.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
The presence of iron uptake (irp-2, fyuA, sitA, fepC, iucA), adhesion (iha, lpfA O157/O141, lpfA O157/O154, efa, toxB) and invasion (inv, ial-related DNA sequences and assignment to the four main Escherichia coli phylogenetic groups (A, B1, B2 e D) were determined in 30 commensal E. coli strains isolated from healthy chickens and in 49 APEC strains isolated from chickens presenting clinical signs of septicemia (n=24) swollen head syndrome (n=14) and omphalitis (n=11) by PCR. None of the strains presented DNA sequences related to the inv, ial, efa, and toxB genes. DNA sequences related to lpfA O157/O154, iucA, fepC, and irp-2 genes were significantly found among pathogenic strains, where iucA gene was associated with septicemia and swollen head syndrome and fepC and irp-2 genes were associated with swollen head syndrome strains. Phylogenetic typing showed that commensal and omphalitis strains belonged mainly to phylogenetic Group A and swollen head syndrome to phylogenetic Group D. Septicemic strains were assigned in phylogenetic Groups A and D. These data could suggest that clonal lineage of septicemic APEC strains have a multiple ancestor origin; one from a pathogenic bacteria ancestor and other from a non-pathogenic ancestor that evolved by the acquisition of virulence related sequences through horizontal gene transfer. Swollen head syndrome may constitute a pathogenic clonal group. By the other side, omphalitis strains probably constitute a non-pathogenic clonal group, and could cause omphalitis as an opportunistic infection. The sharing of virulence related sequences by human pathogenic E. coli and APEC strains could indicate that APEC strains could be a source of virulence genes to human strains and could represent a zoonotic risk.
Resumo:
When the first group of DNA puffs is active in the salivary gland regions S1 and S3 of Bradysia hygida larvae, there is a large increase in the production and secretion of new salivary proteins demonstrable by [3H]-Leu incorporation. The present study shows that protein separation by SDS-PAGE and detection by fluorography demonstrated that these polypeptides range in molecular mass from about 23 to 100 kDa. Furthermore, these proteins were synthesized mainly in the S1 and S3 salivary gland regions where the DNA puffs C7, C5, C4 and B10 are conspicuous, while in the S2 region protein synthesis was very low. Others have shown that the extent of amplification for DNA sequences that code for mRNA in the DNA puffs C4 and B10 was about 22 and 10 times, respectively. The present data for this group of DNA puffs are consistent with the proposition that gene amplification is necessary to provide some cells with additional gene copies for the production of massive amounts of proteins within a short period of time (Spradling AC and Mahowald AP (1980) Proceedings of the National Academy of Sciences, USA, 77: 1096-1100).
Resumo:
At first Rickettsia conorii was implicated as the causative agent of spotted fever in Uruguay diagnosed by serological assays. Later Rickettsia parkeri was detected in human-biting Amblyomma triste ticks using molecular tests. The natural vector of R. conorii, Rhipicephalus sanguineus, has not been studied for the presence of rickettsial organisms in Uruguay. To address this question, 180 R. sanguineus from dogs and 245 A. triste from vegetation (flagging) collected in three endemic localities were screened for spotted fever group (SFG) rickettsiosis in southern Uruguay. Tick extracted DNA pools were subjected to PCR using primers which amplify a fragment of the rickettsial gltA gene. Positive tick DNA pools with these primers were subjected to a second PCR round with primers targeting a fragment of the ompA gene, which is only present in SFG rickettsiae. No rickettsial DNA was detected in R. sanguineus. However, DNA pools of A. triste were found to be positive for a rickettsial organism in two of the three localities, with prevalences of 11.8% to 37.5% positive pools. DNA sequences generated from these PCR-positive ticks corresponded to R. parkeri. These findings, joint with the aggressiveness shown by A. triste towards humans, support previous data on the involvement of A. triste as vector of human infections caused by R. parkeri in Uruguay.
Resumo:
The clinical application of CCR5 antagonists involves first determining the coreceptor usage by the infecting viral strain. Bioinformatics programs that predict coreceptor usage could provide an alternative method to screen candidates for treatment with CCR5 antagonists, particularly in countries with limited financial resources. Thus, the present study aims to identify the best approach using bioinformatics tools for determining HIV-1 coreceptor usage in clinical practice. Proviral DNA sequences and Trofile results from 99 HIV-1-infected subjects under clinical monitoring were analyzed in this study. Based on the Trofile results, the viral variants present were 81.1% R5, 21.4% R5X4 and 1.8% X4. Determination of tropism using a Geno2pheno[coreceptor] analysis with a false positive rate of 10% gave the most suitable performance in this sampling: the R5 and X4 strains were found at frequencies of 78.5% and 28.4%, respectively, and there was 78.6% concordance between the phenotypic and genotypic results. Further studies are needed to clarify how genetic diversity amongst virus strains affects bioinformatics-driven approaches for determining tropism. Although this strategy could be useful for screening patients in developing countries, some limitations remain that restrict the wider application of coreceptor usage tests in clinical practice.
Resumo:
This study describes the development and application of a new PCR assay for the specific detection of pathogenic leptospires and its comparison with a previously reported PCR protocol. New primers were designed for PCR optimization and evaluation in artificially-infected paraffin-embedded tissues. PCR was then applied to post-mortem, paraffin-embedded samples, followed by amplicon sequencing. The PCR was more efficient than the reported protocol, allowing the amplification of expected DNA fragment from the artificially infected samples and from 44% of the post-mortem samples. The sequences of PCR amplicons from different patients showed >99% homology with pathogenic leptospires DNA sequences. The applicability of a highly sensitive and specific tool to screen histological specimens for the detection of pathogenic Leptospira spp. would facilitate a better assessment of the prevalence and epidemiology of leptospirosis, which constitutes a health problem in many countries.