252 resultados para DNA Fingerprinting

em Scielo Saúde Pública - SP


Relevância:

100.00% 100.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Isolates of Mycobacterium tuberculosis derived from patients with AIDS from a single hospital in Rio de Janeiro were typed using a standardized RFLP technique detecting IS6110 polymorphism. Nineteen isolates were obtained from 15 different patients. Eleven distinct IS6110 patterns were found, with 4 banding patterns shared by 2 patients. The clustering value of 53% was much higher in comparison with clustering of M. tuberculosis strains from TB patients without clinical signs for HIV infection from randomly selected health centers. We present these results as preliminary data on M. tuberculosis strain polymorphism in Brazil and on the higher risk for recent transmission amongst patients with AIDS

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Differences were detected in the gene expression of strains of E. histolytica using RNA (RAP-PCR) and DNA fingerprinting (RAPD). Analysis of the electrophoretic profiles of the gels revealed some polymorphic markers that could be used in the individual characterization of the strains. The 260 bands generated by using five different primers for RAP-PCR, as well as RAPD, were employed in the construction of dendograms. The dendogram obtained based on the RAPD products permitted the distinction of symptomatic and asymptomatic isolates, as well the correlation between the polymorphism exhibited and the virulence of the strains. The dendogram obtained for the RAP-PCR products did not show a correlation with the virulence of the strains but revealed a high degree of intraspecific transcriptional variability that could be related to other biological features, whether or not these are involved in the pathogenesis of amebiasis.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The development of in vitro propagation of cells has been an extraordinary technical advance for several biological studies. The correct identification of the cell line used, however, is crucial, as a mistaken identity or the presence of another contaminating cell may lead to invalid and/or erroneous conclusions. We report here the application of a DNA fingerprinting procedure (directed amplification of minisatellite-region DNA), developed by Heath et al. [Nucleic Acids Research (1993) 21: 5782-5785], to the characterization of cell lines. Genomic DNA of cells in culture was extracted and amplified by PCR in the presence of VNTR core sequences, and the amplicons were separated by agarose gel electrophoresis. After image capture with a digital camera, the banding profiles obtained were analyzed using a software (AnaGel) specially developed for the storage and analysis of electrophoretic fingerprints. The fingerprints are useful for construction of a data base for identification of cell lines by comparison to reference profiles as well as comparison of similar lines from different sources and periodic follow-up of cells in culture.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Abstract: INTRODUCTION Characterization of Mycobacterium tuberculosis (MTB) isolates by DNA fingerprinting has contributed to tuberculosis (TB) control. The aim of this study was to determine the genetic diversity of MTB isolates from Tehran province in Iran. METHODS MTB isolates from 60 Iranian and 10 Afghan TB patients were fingerprinted by standard IS6110-restriction fragment length polymorphism (RFLP) analysis and spoligotyping. RESULTS The copy number of IS6110 ranged from 10-24 per isolate. The isolates were classified into 22 clusters showing ≥ 80% similarity by RFLP analysis. Fourteen multidrug-resistant (MDR) isolates were grouped into 4 IS6110-RFLP clusters, with 10 isolates [71% (95% CI: 45-89%)] in 1 cluster, suggesting a possible epidemiological linkage. Eighteen Iranian isolates showed ≥ 80% similarity with Afghan isolates. There were no strains with identical fingerprints. Spoligotyping of 70 isolates produced 23 distinct patterns. Sixty (85.7%) isolates were grouped into 13 clusters, while the remaining 10 isolates (14.2%) were not clustered. Ural (formerly Haarlem4) (n = 22, 31.4%) was the most common family followed by Central Asian strain (CAS) (n = 18, 25.7%) and T (n = 9, 12.8%) families. Only 1strain was characterized as having the Beijing genotype. Among 60 Iranian and 10 Afghan MTB isolates, 25% (95% CI: 16-37) and 70% (95% CI: 39-89) were categorized as Ural lineage, respectively. CONCLUSIONS A higher prevalence of Ural family MTB isolates among Afghan patients than among Iranian patients suggests the possible transmission of this lineage following the immigration of Afghans to Iran.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Clone CL Brener is the reference organism used in the Trypanosoma cruzi Genome Project. Some biological parameters of CL Brener were determined: (a) the doubling time of epimastigote forms cultured in liver infusion-tryptose (LIT) medium at 28oC is 58±13 hr; (b) differentiation of epimastigotes to metacyclic trypomastigotes is obtained by incubation in LIT-20% Grace´s medium; (c) trypomastigotes infect mammalian cultured cells and perform the complete intracellular cycle at 33 and 37oC; (d) blood forms are highly infective to mice; (e) blood forms are susceptible to nifurtimox and benznidazole. The molecular typing of CL Brener has been determined: (a) isoenzymatic profiles are characteristic of zymodeme ZB; (b) PCR amplification of a 24Sa ribosomal RNA sequence indicates it belongs to T. cruzi lineage 1; (c) schizodeme, randomly amplified polymorphic DNA (RAPD) and DNA fingerprinting analyses were performed

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The combination of molecular and conventional epidemiological methods has improved the knowledge about the transmission of tuberculosis in urban populations. To examine transmission of tuberculosis in Havana, Cuba, with DNA fingerprinting, we studied 51 out of 92 Mycobacterium tuberculosis strains isolated from tuberculosis patients who resided in Havana and whose infection was culture-confirmed in the period from September 1997 to March 1998. Isolates from 28 patients (55%) had unique IS6110 restriction fragment length polymorphism (RFLP) patterns, while isolates from 23 others (45%) had identical patterns and belonged to 7 clusters. Three clusters consisting of six, five and two cases were each related to small outbreaks that occurred in a closed setting. Three other clustered cases were linked to a large outbreak that occurred in another institution. Younger patients were more correlated to clustering than older ones. The finding that 45% of the isolates had clustered RFLP patterns suggests that recent transmission is a key factor in the tuberculosis cases in Havana. The IS6110 RFLP typing made it possible to define the occurrence of outbreaks in two closed institutions.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Tuberculosis (TB) is a major concern in developing countries. In Brazil, few genotyping studies have been conducted to verify the number of IS6110 copies present in local prevalent strains of Mycobacterium tuberculosis, the distribution and clustering of strains. IS6110 DNA fingerprinting was performed on a sample of M. tuberculosis isolates from patients with AFB smear-positive pulmonary TB, at a hospital in Brazil. The IS6110 profiles were analyzed and compared to a M. tuberculosis database of the Houston Tuberculosis Initiative, Houston, US. Seventy-six fingerprints were obtained from 98 patients. All M. tuberculosis strains had an IS6110 copy number between 5-21 allowing for differentiation of the isolates. Human immunodeficiency virus infection was confirmed in nearly half the patients of whom data was available. Fifty-eight strains had unique patterns, while 17 strains were grouped in 7 clusters (2 to 6 strains). When compared to the HTI database, 6 strains matched isolates from El Paso, Ciudad de Juarez, Houston, and New York. Recently acquired infections were documented in 19% of cases. The community transmission of infection is intense, since some clustered strains were recovered during the four-year study period. The intercontinental dissemination of M. tuberculosis strains is suspected by demonstration of identical fingerprints in a distant country.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Until recently, morphotyping, a method evaluating fringe and surface characteristics of streak colonies grown on malt agar, has been recommended as a simple and unexpensive typing method for Candida albicans isolates. The discriminatory power and reproducibility of Hunter's modified scheme of Phongpaichit's morphotyping has been evaluated on 28 C. albicans isolates recovered from the oral cavity of asymptomatic human immunodeficiency virus-positive subjects, and compared to two molecular typing methods: randomly amplified polymorphic DNA (RAPD) fingerprinting, and contour clamped homogeneous electric field (CHEF) electrophoretic karyotyping. Morphological features of streak colonies allowed to distinguish 11 different morphotypes while RAPD fingerprinting yielded 25 different patterns and CHEF electrophoresis recognized 9 karyotypes. The discriminatory power calculated with the formula of Hunter and Gaston was 0.780 for morphotyping, 0.984 for RAPD fingerprinting, and 0.630 for karyotyping. Reproducibility was tested using 43 serial isolates from 15 subjects (2 to 6 isolates per subject) and by repeating the test after one year storage of the isolates. While genetic methods generally recognized a single type for all serial isolates from each of the subjects studied, morphotyping detected strain variations in five subjects in the absence of genetic confirmation. Poor reproducibility was demonstrated repeating morphotyping after one year storage of the isolates since differences in at least one character were detected in 92.9% of the strains.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

An epidemic of sporotrichosis, a subcutaneous mycosis caused by the fungus Sporothrix schenckii, is ongoing in Rio de Janeiro, Brazil, in which cases of human infection are related to exposure to cats. In an attempt to demonstrate the zoonotic character of this epidemic using molecular methodology, we characterised by DNA-based typing methods 19 human and 25 animal S. schenckii isolates from the epidemic, as well as two control strains. To analyse the isolates, the random amplified polymorphic DNA (RAPD) technique was performed using three different primers, together with DNA fingerprinting using the minisatellite derived from the wild-type phage M13 core-sequence. The analyses generated amplicons with considerable polymorphism. Although isolates exhibited high levels of genetic relatedness, they could be clustered into 5-10 genotypes. The RAPD profiles of epidemic S. schenckii isolates could be distinguished from that of the United States isolate, displaying 20% similarity to each primer and 60% when amplified with the M13 primer. DNA fingerprinting of S. schenckii isolated from the nails (42.8%) and the oral cavities (66%) of cats were identical to related human samples, suggesting that there is a common infection source for animals and humans in this epidemic. It is clear that cats act as a vehicle for dissemination of S. schenckii.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The first phytopathogenic bacterium with its DNA entirely sequenced is being detected and isolated from different host plants in several geographic regions. Although it causes diseases in cultures of economic importance, such as citrus, coffee, and grapevine little is known about the genetic relationships among different strains. Actually, all strains are grouped as a single species, Xylella fastidiosa, despite colonizing different hosts, developing symptoms, and different physiological and microbiological observed conditions. The existence of genetic diversity among X. fastidiosa strains was detected by different methodological techniques, since cultural to molecular methods. However, little is know about the phylogenetic relationships developed by Brazilian strains obtained from coffee and citrus plants. In order to evaluate it, fAFLP markers were used to verify genetic diversity and phylogenetic relationships developed by Brazilian and strange strains. fAFLP is an efficient technique, with high reproducibility that is currently used for bacterial typing and classification. The obtained results showed that Brazilian strains present genetic diversity and that the strains from this study were grouped distinctly according host and geographical origin like citrus-coffee, temecula-grapevine-mulberry and plum-elm.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

An epidemic of rice (Oryza sativa) blast occurred on cultivars Epagri 108 and 109 in the municipalities of Lagoa da Confusão and Duerê in the State of Tocantins, during the rice-growing season 1998-99. DNA fingerprinting and virulence phenotype analysis were utilized to determine the diversity of Pyricularia grisea isolates collected from these cultivars in one epidemic year. Rep-PCR analysis of isolates was done by using two primer sequences from Pot2. Two distinct fingerprint groups or lineages were identified among 53 isolates collected from nine different commercial fields. The virulence pattern of isolates retrieved from these two cultivars was analyzed in artificial inoculation tests utilizing 32 genotypes in the greenhouse. A dendrogram constructed from virulence phenotype data showed a single group considering 77% similarity level. The predominant pathotype IB-45 was represented by 47 of the 53 isolates corresponding to 83%. Four other pathotypes (IB-1, IB-9, IB-13 and IB-41) were identified at random among the isolates from these cultivars. There was no relation between rep-PCR grouping and pathotypes. The results showed that the isolates of P. grisea recovered from cultivars Epagri108 and 109 in farmers' fields had narrow phenotypic and genetic diversity. The blast outbreak on these two cultivars one year after their introduction could be attributed to the new pathotype IB-45 or its increase, which was hitherto existing in low frequency.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Random amplified polymorphic DNA (RAPD) technique is a simple and reliable method to detect DNA polymorphism. Several factors can affect the amplification profiles, thereby causing false bands and non-reproducibility of assay. In this study, we analyzed the effect of changing the concentration of primer, magnesium chloride, template DNA and Taq DNA polymerase with the objective of determining their optimum concentration for the standardization of RAPD technique for genetic studies of Cuban Triatominae. Reproducible amplification patterns were obtained using 5 pmoL of primer, 2.5 mM of MgCl2, 25 ng of template DNA and 2 U of Taq DNA polymerase in 25 µL of the reaction. A panel of five random primers was used to evaluate the genetic variability of T. flavida. Three of these (OPA-1, OPA-2 and OPA-4) generated reproducible and distinguishable fingerprinting patterns of Triatominae. Numerical analysis of 52 RAPD amplified bands generated for all five primers was carried out with unweighted pair group method analysis (UPGMA). Jaccard's Similarity Coefficient data were used to construct a dendrogram. Two groups could be distinguished by RAPD data and these groups coincided with geographic origin, i.e. the populations captured in areas from east and west of Guanahacabibes, Pinar del Río. T. flavida present low interpopulation variability that could result in greater susceptibility to pesticides in control programs. The RAPD protocol and the selected primers are useful for molecular characterization of Cuban Triatominae.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Optimization of the RAPD reaction for characterizing Salmonella enterica serovar Typhi strains was studied in order to ensure the reproducibility and the discriminatory power of this technique. Eight Salmonella serovar Typhi strains isolated from various regions in Brazil were examined for the fragment patterns produced using different concentrations of DNA template, primer, MgCl2 and Taq DNA polymerase. Using two different low stringency thermal cycle profiles, the RAPD fingerprints obtained were compared. A set of sixteen primers was evaluated for their ability to produce a high number of distinct fragments. We found that variations associated to all of the tested parameters modified the fingerprinting patterns. For the strains of Salmonella enterica serovar Typhi used in this experiment, we have defined a set of conditions for RAPD-PCR reaction, which result in a simple, fast and reproducible typing method.