7 resultados para Cytokeratin
em Scielo Saúde Pública - SP
Resumo:
PURPOSE:To compare the prognostic and predictive features between in situ and invasive components of ductal breast carcinomas. METHODS:We selected 146 consecutive breast samples with ductal carcinoma in situ (DCIS) associated with adjacent invasive breast carcinoma (IBC). We evaluated nuclear grade and immunohistochemical expression of estrogen receptor (ER), progesterone receptor (PR), human epidermal growth factor receptor 2 (HER2), cytokeratin 5/6 (CK5/6), and epidermal growth factor receptor (EGFR) in both components, in situ and invasive, and the Ki-67 percentage of cells in the invasive part. The DCIS and IBC were classified in molecular surrogate types determined by the immunohistochemical profile as luminal (RE/PR-positive/ HER2-negative), triple-positive (RE/RP/HER2-positive), HER2-enriched (ER/PR-negative/HER2-positive), and triple-negative (RE/RP/HER2-negative). Discrimination between luminal A and luminal B was not performed due to statistical purposes. Correlations between the categories in the two groups were made using the Spearman correlation method. RESULTS:There was a significant correlation between nuclear grade (p<0.0001), expression of RE/RP (p<0.0001), overexpression of HER2 (p<0.0001), expression of EGFR (p<0.0001), and molecular profile (p<0.0001) between components in situ and IBC. CK 5/6 showed different distribution in DCIS and IBC, presenting a significant association with the triple-negative phenotype in IBC, but a negative association among DCIS. CONCLUSIONS: Our results suggest that classical prognostic and predictive features of IBC are already determined in the preinvasive stage of the disease. However the role of CK5/6 in invasive carcinoma may be different from the precursor lesions.
Resumo:
Samples of gastric lymph nodes and the stomachs from 24 pigs selected from herds affected by postweaning multisystemic wasting syndrome (PMWS) and sudden death associated with gastric ulcers were studied. Pigs were selected on the basis of unthriftiness, decreased feed intake, and wasting. The stomachs were opened, inverted, and classified into 0-3 score according the severity of the gross lesions present in pars oesophagica (non-glandulargastric mucosa). Selected samples were processed for paraffin embedding and stained with hematoxylin and eosin. Immunohistochemistry using anti-PCV2 (porcine circovírus type 2) antibody, anti-Helicobacter pylori antibody and a wide-spectrum anti-cytokeratin antibody was performed. Gross changes in pars oesophagea were classified according to the severity of lesions as score 3, 2, and 1 in 8, 6, 5 stomachs respectivelly. Microscopically, hyperplastic lymphoid follicles, lymphohistiocytic inflammatory infiltrates and focci of necrosis in the gastric mucosa were common findings. Large amounts of PCV2 antigen were observed in the cytoplasm and nuclei from intralesional cells and debris from the gastric glandular mucosal zone; however, in the fundus, anti-PCV2 immunostaining was restricted to the surface mucosal cells and foveolar compartment. All gastric lymph nodes were positive for PCV2 antigen. Anti-H. pylori immunostaining was seen in eleven cases, mainly in the antrum, on the mucosal surface and foveolar compartment. The association of the anti-PCV2 immunostaining with the glandular mucus-producing cells suggests a role for PCV2 as an additional factor for the swine ulcer development.
Resumo:
This paper describes the use of a panel of antibodies (CD117, CD3, CD79a, CD45, cytokeratin, vimentin and E-cadherin) on formalin-fixed, paraffin-embedded sections of canine cutaneous round cell tumours. Neoplastic tumours were diagnosed by histology and histochemical stains and included 107 mast cell tumours, 31 cutaneous histiocytomas, two localized histiocytic sarcomas, 21 cutaneous lymphomas, three plasma cell tumours, one transmissible venereal tumour and seven unclassified round cell tumours. The histologic diagnosis was modified in 39.5% of the total 172 neoplasms. The staining for CD45 and Ecadherin were variable, and therefore, the final diagnoses of cutaneous histiocytoma and localized histiocytic sarcoma were made based on histology in association with negative results for CD3, CD79a, CD117 and cytokeratin. The cellular origin of unclassified round cell tumours was defined in all cases. Cutaneous B-cell lymphoma and plasma cell tumours were CD79a-positive and could be distinguished from each other by the morphological characteristics. Mast cell tumours and T cell lymphoma were CD117 and CD3 positive, respectively. The positive staining for vimentin and the negative staining for CD3, CD79a, CD117 and cytokeratin favoured the diagnosis of transmissible venereal tumours. Thus, the final diagnosis of cutaneous round cell tumours should be based on the interpretation of immunohistochemical results together with the cellular morphology observed by histology. Therefore, more studies to optimize the specific markers in formalin-fixed, paraffinembedded tissues (especially for histiocytes) are required for definitive diagnosis of round cell tumours in dogs.
Resumo:
This paper reports a case of nonpapillary and infiltrative transitional cell carcinoma (TCC) of the urinary bladder with metastasis of lumbar vertebrae and spinal cord compression in an adult female ocelot (Leopardus pardalis), from the Mato Grosso state, Brazil. The ocelot had pelvic limb paralysis and skin ulcers in the posterior region of the body and was submitted to euthanasia procedure. At necropsy was observed a multilobulated and irregular shaped, yellowish to white nodule in the urinary bladder. The nodule had a soft consistency and arised from the mucosa of the urinary bladder extending throughout the muscular layers and the serosa. Nodules of similar appearance infiltrating the vertebral column the at L6 and L7 vertebrae with corresponding spinal canal invasion were also observed. The histological evaluation showed epithelial neoplastic proliferation in the urinary bladder with characteristics of nonpapillary and infiltrative TCC, with positive immunohistochemical staining for pancytokeratin, and strong immunostaining for cytokeratin of low molecular weight, and weak or absent labeling for high molecular weight cytokeratin. This is the first report of TCC of urinary bladder in ocelot in Brazil.
Resumo:
We present an ultrastructural study of the utilization of human amniotic membrane in the treatment of congenital absence of the vagina in 10 patients. All patients were surgically treated with application of an amniotic membrane graft using the modified McIndoe and Bannister technique. Sixty days after surgery, samples of the vaginal neo-epithelium were collected for transmission electron microscopy analysis. The ultrastructural findings consisted of a lining of mature squamous epithelium indicating the occurrence of metaplasia of the amniotic epithelium into the vaginal epithelium. The cells were arranged in layers as in the normal vaginal epithelium, i.e., superficial, intermediate and deep layers. There were desmosomes and cytoplasmic intermediate cytokeratin filaments, as well as some remnant features of the previous amniotic epithelium. These findings suggest that human amniotic membrane is able to complete metaplasia into squamous cells but the mechanism of this cellular transformation is unknown
Resumo:
Epithelium, a highly dynamic system, plays a key role in the homeostasis of the intestine. However, thus far a human intestinal epithelial cell line has not been established in many countries. Fetal tissue was selected to generate viable cell cultures for its sterile condition, effective generation, and differentiated character. The purpose of the present study was to culture human intestinal epithelial cells by a relatively simple method. Thermolysin was added to improve the yield of epithelial cells, while endothelin-3 was added to stimulate their growth. By adding endothelin-3, the achievement ratio (viable cell cultures/total cultures) was enhanced to 60% of a total of 10 cultures (initiated from 8 distinct fetal small intestines), allowing the generation of viable epithelial cell cultures. Western blot, real-time PCR and immunofluorescent staining showed that cytokeratins 8, 18 and mouse intestinal mucosa-1/39 had high expression levels in human intestinal epithelial cells. Differentiated markers such as sucrase-isomaltase, aminopeptidase N and dipeptidylpeptidase IV also showed high expression levels in human intestinal epithelial cells. Differentiated human intestinal epithelial cells, with the expression of surface markers (cytokeratins 8, 18 and mouse intestinal mucosa-1/39) and secretion of cytokines (sucrase-isomaltase, aminopeptidase N and dipeptidylpeptidase IV), may be cultured by the thermolysin and endothelin-3 method and maintained for at least 20 passages. This is relatively simple, requiring no sophisticated techniques or instruments, and may have a number of varied applications.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.