75 resultados para CELL-ENVELOPE
em Scielo Saúde Pública - SP
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
The hepatitis C virus (HCV) encodes approximately 10 different structural and non-structural proteins, including the envelope glycoprotein 2 (E2). HCV proteins, especially the envelope proteins, bind to cell receptors and can damage tissues. Endothelial inflammation is the most important determinant of fibrosis progression and, consequently, cirrhosis. The aim of this study was to evaluate and compare the inflammatory response of endothelial cells to two recombinant forms of the HCV E2 protein produced in different expression systems (Escherichia coli and Pichia pastoris). We observed the induction of cell death and the production of nitric oxide, hydrogen peroxide, interleukin-8 and vascular endothelial growth factor A in human umbilical vein endothelial cells (HUVECs) stimulated by the two recombinant E2 proteins. The E2-induced apoptosis of HUVECs was confirmed using the molecular marker PARP. The apoptosis rescue observed when the antioxidant N-acetylcysteine was used suggests that reactive oxygen species are involved in E2-induced apoptosis. We propose that these proteins are involved in the chronic inflammation caused by HCV.
Resumo:
Hepatitis C virus (HCV) envelope protein 2 (E2) is involved in viral binding to host cells. The aim of this work was to produce recombinant E2B and E2Y HCV proteins in Escherichia coli and Pichia pastoris, respectively, and to study their interactions with low-density lipoprotein receptor (LDLr) and CD81 in human umbilical vein endothelial cells (HUVEC) and the ECV304 bladder carcinoma cell line. To investigate the effects of human LDL and differences in protein structure (glycosylated or not) on binding efficiency, the recombinant proteins were either associated or not associated with lipoproteins before being assayed. The immunoreactivity of the recombinant proteins was analysed using pooled serum samples that were either positive or negative for hepatitis C. The cells were immunophenotyped by LDLr and CD81 using flow cytometry. Binding and binding inhibition assays were performed in the presence of LDL, foetal bovine serum (FCS) and specific antibodies. The results revealed that binding was reduced in the absence of FCS, but that the addition of human LDL rescued and increased binding capacity. In HUVEC cells, the use of antibodies to block LDLr led to a significant reduction in the binding of E2B and E2Y. CD81 antibodies did not affect E2B and E2Y binding. In ECV304 cells, blocking LDLr and CD81 produced similar effects, but they were not as marked as those that were observed in HUVEC cells. In conclusion, recombinant HCV E2 is dependent on LDL for its ability to bind to LDLr in HUVEC and ECV304 cells. These findings are relevant because E2 acts to anchor HCV to host cells; therefore, high blood levels of LDL could enhance viral infectivity in chronic hepatitis C patients.
Resumo:
The aim of this paper is to analyze the determining factors for the pricing of handsets sold with service plans, using the hedonic price method. This was undertaken by building a database comprising 48 handset models, under nine different service plans, over a period of 53 weeks in 2008, and resulted in 27 different attributes and a total number of nearly 300,000 data registers. The results suggest that the value of monthly subscriptions and calling minutes are important to explain the prices of handsets. Furthermore, both the physical volume and number of megapixels of a camera had an effect on the prices. The bigger the handset, the cheaper it becomes, and the more megapixels a camera phone has, the more expensive it becomes. Additionally, it was found that in 2008 Brazilian phone companies were subsidizing enabled data connection handsets.
Resumo:
A controlled trial was performed with the purpose of investigating which factors could be considered of significant risk for the development of basal cell carcinoma. A total of 259 cases of basal cell carcinoma diagnosed from July 1991 to July 1992 were compared with 518 controls matched for age and sex. All subjects in both groups were white. Protocol data were submitted to statistical analysis by the chi-square test and by multiple conditional logistic regression analysis and the following conclusions were reached: 1) light skin color (types I and II of the Fitzpatrick classification), odds ratio of 2.8; outdoor work under constant sunlight, odds ratio of 5.0; the presence of actinic lesions due to exposure to the sun, odds ratio of 4.9, are risk factors perse. 2) Type III skin in the Fitzpatrick classification only represents a risk factor when the patient reports a history of intense sunburns, but not in the absence of such a history. 3) Sunburns per se do not represent a risk factor althorig the point made in item 2 of these conclusions is valid. 4) Other suspected risk factors whose significance was not confirmed by multiple conditioned logistic regression analysis were: residence in rural areas, light eyes and blond hair color, extent of the awareness of the "sun x skin cancer" relationship, familial occurrence of skin cancer, excessive exposure to the sun, and freckles appearing in childhood.
Resumo:
OBJECTIVE: The rapid growth of the rubella virus in RC-IAL² with development of cytopathic effect, in response to rubella virus infection, is described. For purposes of comparison, the rubella virus RA-27/3 strain was titered simultaneously in the RC-IAL, Vero, SIRC and RK13 cell lines. METHODS: Rubella virus RA-27/3 strain are inoculated in the RC-IAL cell line (rabbit Kidney, Institute Adolfo Lutz). Plates containing 1.5x10(5) cells/ml of RC-IAL line were inoculated with 0.1ml s RA-27/3 strain virus containing 1x 10(4)TCID50/0.1ml. A 25% cytopathic effect was observed after 48 hours and 100% after 96 hours. The results obtained were compared to those observed with the SIRC, Vero and RK13 cell lines. Rubella virus was detected by immunohistochemistry. RESULTS: With the results, it was possible to conclude that the RC-IAL cell line is a very good substrate for culturing rubella virus. The cells inoculated with rubella virus were examined by phase contrast microscopy and showed the characteristic rounded, bipolar and multipolar cells. The CPE in RC-IAL was observed in the first 48 hours and the curve of the increased infectivity was practically the same as observed in other cell lines. CONCLUSIONS: These findings are important since this is one the few cell lines described in the literature with a cytopathic effect. So it can be used for antigen preparation and serological testing for the diagnosis of specific rubella antibodies.
Comment on: Loureiro & Rozenfeld "Epidemiology of sickle cell disease hospital admissions in Brazil"
Resumo:
Differences in cell charge between epimastigote and trypomastigote populations were compared in Y, Cl and Colombiana strains of T. cruzi. Trypomastigote populations were more homogenous in relation to cell charge than epimastigotes. This homogeneity of cell charge was not the result of the selection of trypomastigote sub-populations by the host immunosystem, but may be the result of a surface coat formed by host blood components.
Resumo:
The occurrence of secondary cell mediated immune response (CMI) in human antirabies immunization was studied. The Puenzalida & Palácios vaccine was used because it is routinely used in Brazil. CMI was evaluated by lymphoblastic transformation indices obtained in whole blood culture in the presence of rabies and control (nervous tissue) antigens. Eleven volunteers submitted to revaccination constituted the group under study, while three other volunteers submitted primo vaccination were utilized as control group. A clear secondary CMI to rabies antigen was detected in all the revaccinated volunteers who showed earlier and more intense response than the control group. Response to the control antigen, however, present in all the components of the first group was not detectable in two out of the three primovaccinated and very low in the third one.
Resumo:
Cell mediated immune response was studied in patients with recent and chronic Schistosoma mansoni infection. Precultured peripheral mononuclear cells showed significantly higher responses to S. mansoni adult worm antigen (SAWA) when compared to fresh cell preparations. The addition of each patient serum to the precultured cells reactions to SAWA or recall antigens demonstrated a strong inhibitory serum action, which was also noted on allogeneic cells derived from healthy subjects. The CD4 subset was the main responding cell to SAWA being this reactivity highly suppressed by the presence of the monocyte macrophage accessory cells. We stressed the simultaneous inhibitory action of humoral and cellular factors on the specific cell response to S. mansoni.
Resumo:
A comparative study of the antigenic profile of bloodstream and cell culture derived trypomastigotes showed many differences in their components. Using mouse anti-T. cruzi antibodies the differences were located mostly in the 120 kDa band, whereas using chagasic patient sera the differences were located in the 85 and 52 kDa bands. These findings might explain known physiological differences between trypomatigotes obtained from cell culture and from infected blood. A brief report of this work has already been published9.
Resumo:
The peritoneal cavity of laboratory mice was used to study the phenomenon of host cell adhesion to different evolutive stages of the Schistosoma mansoni (cercaria, adult worm, developing and mature eggs, miracidium, young and mature daughter sporocysts). Material recovered from the peritoneal cavity 30 and 180 min after the inoculation of each evolutive form was examined with the help of a stereomicroscope. The free swimming larvae (cercaria and miracidium), and the evolutive forms producing such larvae (mature egg and mature daughter sporocyst) elicited the host cell adhesion phenomenon. In all forms but cercariae the adherent cells remained as so till 180 minutes after inoculation
Resumo:
Cercariae of Schistosoma mansoni inoculated into the peritoneal cavity of naive mice induced host cell adhesion to their surface, but after 90 minutes the number of adherent cells sharply decreased. The cell detachment is progressive and simultaneous to the cercaria-schistosomule transformation. The histological study showed mainly neutrophils in close contact with the larvae. Mononuclear cells and some eosinophils were occasionally seen surrounding the adherent neutrophils. The scanning electron microscopy showed cells displaying twisted microvilli and several microplicae contacting or spreading over the larval surface, and larvae completely surrounded by clusters of cells. These results suggest that the neutrophils recognize molecules on the cercarial surface which induce their spreading
Resumo:
The treatment of naive mice with high closes of oxamniquine, 1 hour before the intraperitoneal inoculation of Schistosoma mansoni cercariae, induces a delay in the transformation process resulting in a longer host cell adhesion.