Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

Current studies find that degenerated cartilage endplates (CEP) of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA) was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis.

Targeting PPM1D by lentivirus-mediated RNA interference inhibits the tumorigenicity of bladder cancer cells

Protein phosphatase magnesium/manganese-dependent 1D (PPM1D) is a p53-induced phosphatase that functions as a negative regulator of stress response pathways and has oncogenic properties. However, the functional role ofPPM1D in bladder cancer (BC) remains largely unknown. In the present study, lentivirus vectors carrying small hairpin RNA (shRNA) targeting PPM1D were used to explore the effects ofPPM1D knockdown on BC cell proliferation and tumorigenesis. shRNA-mediated knockdown of PPM1D significantly inhibited cell growth and colony forming ability in the BC cell lines 5637 and T24. Flow cytometric analysis showed that PPM1D silencing increased the proportion of cells in the G0/G1 phase. Downregulation of PPM1Dalso inhibited 5637 cell tumorigenicity in nude mice. The results of the present study suggest that PPM1D plays a potentially important role in BC tumorigenicity, and lentivirus-mediated delivery of shRNA againstPPM1D might be a promising therapeutic strategy for the treatment of BC.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.