15 resultados para Antisense

em Scielo Saúde Pública - SP


Relevância:

20.00% 20.00%

Publicador:

Resumo:

We investigated the participation of neuropeptide Y-Y1 receptors within the medial preoptic area in luteinizing hormone, follicle-stimulating hormone and prolactin release. Four bilateral microinjections of sense (control) or antisense 18-base oligonucleotides of messenger ribonucleic acid (mRNA) (250 ng) corresponding to the NH2-terminus of the neuropeptide Y1 receptor were performed at 12-h intervals for two days into the medial preoptic area of ovariectomized Wistar rats (N = 16), weighing 180 to 200 g, treated with estrogen (50 µg) and progesterone (25 mg) two days before the experiments between 8.00 and 10:00 a.m. Blockade of Y1 receptor synthesis in the medial preoptic area by the antisense mRNA did not change plasma luteinizing hormone or follicle-stimulating hormone but did increase prolactin from 19.6 ± 5.9 ng/ml in the sense group to 52.9 ± 9.6 ng/ml in the antisense group. The plasma hormones were measured by radioimmunoassay and the values are reported as mean ± SEM. These data suggest that endogenous neuropeptide Y in the medial preoptic area has an inhibitory action on prolactin secretion through Y1 receptors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The biological functions of the BC047440 gene highly expressed by hepatocellular carcinoma (HCC) are unknown. The objective of this study was to reconstruct antisense eukaryotic expression vectors of the gene for inhibiting HepG2 cell proliferation and suppressing their xenograft tumorigenicity. The full-length BC047440 cDNA was cloned from human primary HCC by RT-PCR. BC047440 gene fragments were ligated with pMD18-T simple vectors and subsequent pcDNA3.1(+) plasmids to construct the recombinant antisense eukaryotic vector pcDNA3.1(+)BC047440AS. The endogenous BC047440 mRNA abundance in target gene-transfected, vector-transfected and naive HepG2 cells was semiquantitatively analyzed by RT-PCR and cell proliferation was measured by the MTT assay. Cell cycle distribution and apoptosis were profiled by flow cytometry. The in vivo xenograft experiment was performed on nude mice to examine the effects of antisense vector on tumorigenicity. BC047440 cDNA fragments were reversely inserted into pcDNA3.1(+) plasmids. The antisense vector significantly reduced the endogenous BC047440 mRNA abundance by 41% in HepG2 cells and inhibited their proliferation in vitro (P < 0.01). More cells were arrested by the antisense vector at the G1 phase in an apoptosis-independent manner (P = 0.014). Additionally, transfection with pcDNA3.1(+)BC047440AS significantly reduced the xenograft tumorigenicity in nude mice. As a novel cell cycle regulator associated with HCC, the BC047440 gene was involved in cell proliferation in vitro and xenograft tumorigenicity in vivo through apoptosis-independent mechanisms.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Eosinophils, along with mast cells are key cells involved in the innate immune response against parasitic infection whereas the adaptive immune response is largely dependent on lymphocytes. In chronic parasitic disease and in chronic allergic disease, IL-5 is predominantly a T cell derived cytokine which is particularly important for the terminal differentiation, activation and survival of committed eosinophil precursors. The human IL-5 gene is located on chromosome 5 in a gene cluster that contains the evolutionary related IL-4 family of cytokine genes. The human IL-5 receptor complex is a heterodimer consisting of a unique a subunit (predominantly expressed on eosinophils) and a beta subunit which is shared between the receptors for IL-3 & GM-CSF (more widely expressed). The a subunit is required for ligand-specific binding whereas association with the beta subunit results in increased binding affinity. The alternative splicing of the alphaIL-5R gene which contains 14 exons can yield several alphaIL-5R isoforms including a membrane-anchored isoform (alphaIL-5Rm) and a soluble isoform (alphaIL-5Rs). Cytokines such as IL-5 produce specific and non-specific cellular responses through specific cell membrane receptor mediated activation of intracellular signal transduction pathways which, to a large part, regulate gene expression. The major intracellular signal transduction mechanism is activation of non-receptor associated tyrosine kinases including JAK and MAP kinases which can then transduce signals via a novel family of transcriptional factors named signal transducers and activators of transcription (STATS). JAK2, STAT1 and STAT 5 appear to be particularly important in IL-5 mediated eosinophil responses. Asthma is characterized by episodic airways obstruction, increased bronchial responsiveness, and airway inflammation. Several studies have shown an association between the number of activated T cells and eosinophils in the airways and abnormalities in FEV1, airway reactivity and clinical severity in asthma. It has now been well documented that IL-5 is highly expressed in the bronchial mucosa of atopic and intrinsic asthmatics and that the increased IL-5 mRNA present in airway tissues is predominantly T cell derived. Immunocytochemical staining of bronchial biopsy sections has confirmed that IL-5 mRNA transcripts are translated into protein in asthmatic subjects. Furthermore, the number of activated CD 4 + T cells and IL-5 mRNA positive cells are increased in asthmatic airways following antigen challenge and studies that have examined IL-5 expression in asthmatic subjects before and after steroids have shown significantly decreased expression following oral corticosteroid treatment in steroid-sensitive asthma but not in steroid resistant and chronic severe steroid dependent asthma. The link between T cell derived IL-5 and eosinophil activation in asthmatic airways is further strengthened by the demonstration that there is an increased number of alphaIL-5R mRNA positive cells in the bronchial biopsies of atopic and non-atopic asthmatic subjects and that the eosinophil is the predominant site of this increased alphaIL-5R mRNA expression. We have also shown that the subset of activated eosinophils that expressed mRNA for membrane bound alpha IL5r inversely correlated with FEV1, whereas the subset of activated eosinophils that expressed mRNA for soluble alphaIL5r directly correlated with FEV1. Hence, not only does this data suggest that the presence of eosinophils expressing alphaIL-5R mRNA contribute towards the pathogenesis of bronchial asthma, but also that the eosinophil phenotype with respect to alphaIL-5R isoform expression is of central importance. Finally, there are several animal, and more recently in vitro lung explant, models of allergen induced eosinophilia, late airway responses(LARS), and bronchial hyperresponsiveness(BHR) - all of which support a link between IL-5 and airway eosinophila and bronchial hyperresponsiveness. The most direct demonstration of T cell involvement in LARS is the finding that these physiological responses can be transferred by CD4+ but not CD8+ T cells in rats. The importance of IL-5 in animal models of allergen induced bronchial hyperresponsiveness has been further demonstrated by a number of studies which have indicated that IL-5 administration is able to induce late phase responses and BHR and that anti-IL-5 antibody can block allergen induced late phase responses and BHR. In summary, activated T lymphocytes, IL5 production and eosinophil activation are particularly important in the asthmatic response. Human studies in asthma and studies in allergic animal models have clearly emphasised the unique role of IL-5 in linking T lymphocytes and adaptive immunity, the eosinophil effector cell, and the asthma phenotype. The central role of activated lymphocytes and eosinophils in asthma would argue for the likely therapeutic success of strategies to block T cell and eosinophil activation (eg steroids). Importantly, more targeted therapies may avoid the complications associated with steroids. Such therapies could target key T cell activation proteins and cytokines by various means including blocking antibodies (eg anti-CD4, anti-CD40, anti-IL-5 etc), antisense oligonucleotides to their specific mRNAs, and/or selective inhibition of the promoter sites for these genes. Another option would be to target key eosinophil activation mechanisms including the aIL5r. As always, the risk to benefit ratio of such strategies await the results of well conducted clinical trials.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Angiostrongylus cantonensis is an important causative agent of eosinophilic meningitis and eosinophilic meningoencephalitis in humans. MicroRNAs (miRNAs) are small non-coding RNAs that participate in a wide range of biological processes. This study employed a deep-sequencing approach to study miRNAs from young adults of A. cantonensis. Based on 16,880,456 high-quality reads, 252 conserved mature miRNAs including 10 antisense miRNAs that belonging to 90 families, together with 10 antisense miRNAs were identified and characterised. Among these sequences, 53 miRNAs from 25 families displayed 50 or more reads. The conserved miRNA families were divided into four groups according to their phylogenetic distribution and a total of nine families without any members showing homology to other nematodes or adult worms were identified. Stem-loop real-time polymerase chain reaction analysis of aca-miR-1-1 and aca-miR-71-1 demonstrated that their level of expression increased dramatically from infective larvae to young adults and then decreased in adult worms, with the male worms exhibiting significantly higher levels of expression than female worms. These findings provide information related to the regulation of gene expression during the growth, development and pathogenesis of young adults of A. cantonensis.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

One old dream of the chemist in the field of the drug research is to create molecules capable of reaching their target with the precision of a missile. To accomplish it these molecules must have the propriety of distinguishing qualitative differences between healthy and diseased cells. A therapy based on this principle, able of eradicating specifically defective cells, or cells affected by a pathogen has an enormous advantage with the regard to the classical approach in which the cytotoxic drugs merely exploit quantitative biochemical and kinetic differences between abnormal and normal cells. We present in this article a review on the chemical synthesis of analogues of desoxyribonucleotides and on results obtained on the specific and irreversible inhibition of undesired genetic expression using the antisense principle.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A large number of DNA sequences corresponding to human and animal transcripts have been filed in data banks, as cDNAs or ESTs (expression sequence tags). However, the actual function of their corresponding gene products is still largely unknown. Several of these genes may play a role in regulation of important biological processes such as cell division, differentiation, malignant transformation and oncogenesis. Elucidation of gene function is based on 2 main approaches, namely, overexpression and expression interference, which respectively mimick or suppress a given phenotype. The currently available tools and experimental approaches to gene functional analysis and the most recent advances in mass cDNA screening by functional analysis are discussed.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx) proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s) can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain) that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Water channels or aquaporins (AQPs) have been identified in a large variety of tissues. Nevertheless, their role in the human gastrointestinal tract, where their action is essential for the reabsorption and secretion of water and electrolytes, is still unclear. The purpose of the present study was to investigate the structure and function of water channels expressed in the human colon. A cDNA fragment of about 420 bp with a 98% identity to human AQP3 was amplified from human stomach, small intestine and colon by reverse transcription polymerase chain reaction (RT-PCR) and a transcript of 2.2 kb was expressed more abundantly in colon than in jejunum, ileum and stomach as indicated by Northern blots. Expression of mRNA from the colon of adults and children but not from other gastrointestinal regions in Xenopus oocytes enhanced the osmotic water permeability, and the urea and glycerol transport in a manner sensitive to an antisense AQP3 oligonucleotide, indicating the presence of functional AQP3. Immunocytochemistry and immunofluorescence studies in human colon revealed that the AQP3 protein is restricted to the villus epithelial cells. The immunostaining within these cells was more intense in the apical than in the basolateral membranes. The presence of AQP3 in villus epithelial cells suggests that AQP3 is implicated in water absorption across human colonic surface cells.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Gene therapy for hypertension is needed for the next generation of antihypertensive drugs. Current drugs, although effective, have poor compliance, are expensive and short-lasting (hours or one day). Gene therapy offers a way to produce long-lasting antihypertensive effects (weeks, months or years). We are currently using two strategies: a) antisense oligodeoxynucleotides (AS-ODN) and b) antisense DNA delivered in viral vectors to inhibit genes associated with vasoconstrictive properties. It is not necessary to know all the genes involved in hypertension, since many years of experience with drugs show which genes need to be controlled. AS-ODN are short, single-stranded DNA that can be injected in naked form or in liposomes. AS-ODN, targeted to angiotensin type 1 receptors (AT1-R), angiotensinogen (AGT), angiotensin converting enzyme, and ß1-adrenergic receptors effectively reduce hypertension in rat models (SHR, 2K-1C) and cold-induced hypertension. A single dose is effective up to one month when delivered with liposomes. No side effects or toxic effects have been detected, and repeated injections can be given. For the vector, adeno-associated virus (AAV) is used with a construct to include a CMV promoter, antisense DNA to AGT or AT1-R and a reporter gene. Results in SHR demonstrate reduction and slowing of development of hypertension, with a single dose administration. Left ventricular hypertrophy is also reduced by AAV-AGT-AS treatment. Double transgenic mice (human renin plus human AGT) with high angiotensin II causing high blood pressure, treated with AAV-AT1-R-AS, show a normalization of blood pressure for over six months with a single injection of vector. We conclude that ODNs will probably be developed first because they can be treated like drugs for the treatment of hypertension with long-term effects. Viral vector delivery needs more engineering to be certain of its safety, but one day may be used for a very prolonged control of blood pressure.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In addition to the mutations that underlie most cases of the multiple endocrine neoplasia type 1 (MEN1) syndrome, somatic mutations of the MEN1 gene have also been described in sporadic tumors like gastrinomas, insulinomas and bronchial carcinoid neoplasm. We examined exon 2 of this gene, where most of the mutations have been described, in 148 endocrine and nonendocrine sporadic tumors. DNA was obtained by phenol/chloroform extraction and ethanol precipitation from 92 formalin-fixed, paraffin-embedded samples, and from 40 fresh tumor tissue samples. We used 5 pairs of primers to encompass the complete coding sequence of exon 2 of the MEN1 gene that was screened by the polymerase chain reaction-single-stranded conformation polymorphism (PCR-SSCP) technique in 78 sporadic thyroid cancers: 28 follicular adenomas, 35 papillary carcinomas, 14 follicular carcinomas, and 1 anaplastic thyroid carcinoma. We also examined 46 adrenal lesions (3 hyperplasias, 3 adenomas and 35 adrenocortical carcinomas, 2 pheochromocytomas, 2 ganglioneuroblastomas, and 1 lymphoma) and 24 breast cancers (6 noninvasive, 16 infiltrating ductal, and 2 invasive lobular tumors). The PCR product of 5 tumors suspected to present band shifts by SSCP was cloned. Direct sense and antisense sequencing did not identify mutations. These results suggest that the MEN1 gene is not important in breast, thyroid or adrenal sporadic tumorigenesis. Because the frequency of mutations varies significantly among tumor subgroups and allelic deletions are frequently observed at 11q13 in thyroid and adrenal cancers, another tumor suppressor gene residing in this region is likely to be involved in the tumorigenesis of these neoplasms.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Oligonucleotides have a wide range of applications in fields such as biotechnology, molecular biology, diagnosis and therapy. However, the spectrum of uses can be broadened by introducing chemical modifications into their structures. The most prolific field in the search for new oligonucleotide analogs is the antisense strategy, where chemical modifications confer appropriate characteristics such as hybridization, resistance to nucleases, cellular uptake, selectivity and, basically, good pharmacokinetic and pharmacodynamic properties. Combinatorial technology is another research area where oligonucleotides and their analogs are extensively employed. Aptamers, new catalytic ribozymes and deoxyribozymes are RNA or DNA molecules individualized from a randomly synthesized library on the basis of a particular property. They are identified by repeated cycles of selection and amplification, using PCR technologies. Modified nucleotides can be introduced either during the amplification procedure or after selection.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The establishment of dorsal-ventral polarity in Drosophila is a complex process which involves the action of maternal and zygotically expressed genes. Interspecific differences in the expression pattern of some of these genes have been described in other species. Here we present the expression of dorsal-ventral genes during early embryogenesis in the lower dipteran Rhynchosciara americana. The expression of four genes, the ventralizing genes snail (sna) and twist (twi) and the dorsalizing genes decapentaplegic (dpp) and zerknüllt (zen), was investigated by whole-mount in situ hybridization. Sense and antisense mRNA were transcribed in vitro using UTP-digoxigenin and hybridized at 55°C with dechorionated fixed embryos. Staining was obtained with anti-digoxigenin alkaline phosphatase-conjugated antibody revealed with NBT-BCIP solution. The results showed that, in general, the spatial-temporal expression of R. americana dorsal-ventral genes is similar to that observed in Drosophila, where twi and sna are restricted to the ventral region, while dpp and zen are expressed in the dorsal side. The differences encountered were subtle and probably represent a particular aspect of dorsal-ventral axis determination in R. americana. In this lower dipteran sna is expressed slightly later than twi and dpp expression is expanded over the lateral ectoderm during cellular blastoderm stage. These data suggest that the establishment of dorsal-ventral polarity in R. americana embryos follows a program similar to that observed in Drosophila melanogaster.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

TP53, a tumor suppressor gene, has a critical role in cell cycle, apoptosis and cell senescence and participates in many crucial physiological and pathological processes. Identification of TP53 polymorphism in older people and age-related diseases may provide an understanding of its physiology and pathophysiological role as well as risk factors for complex diseases. TP53 codon 72 (TP53:72) polymorphism was investigated in 383 individuals aged 66 to 97 years in a cohort from a Brazilian Elderly Longitudinal Study. We investigated allele frequency, genotype distribution and allele association with morbidities such as cardiovascular disease, type II diabetes, obesity, neoplasia, low cognitive level (dementia), and depression. We also determined the association of this polymorphism with serum lipid fractions and urea, creatinine, albumin, fasting glucose, and glycated hemoglobin levels. DNA was isolated from blood cells, amplified by PCR using sense 5'-TTGCCGTCCCAAGCAATGGATGA-3' and antisense 5'-TCTGGGAAGGGACAGAAGATGAC-3' primers and digested with the BstUI enzyme. This polymorphism is within exon 4 at nucleotide residue 347. Descriptive statistics, logistic regression analysis and Student t-test using the multiple comparison test were used. Allele frequencies, R (Arg) = 0.69 and P (Pro) = 0.31, were similar to other populations. Genotype distributions were within Hardy-Weinberg equilibrium. This polymorphism did not show significant association with any age-related disease or serum variables. However, R allele carriers showed lower HDL levels and a higher frequency of cardiovascular disease than P allele subjects. These findings may help to elucidate the physiopathological role of TP53:72 polymorphism in Brazilian elderly people.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Small cell lung cancer (SCLC) is an aggressive disease, representing 15% of all cases of lung cancer, has high metastatic potential and low prognosis that urgently demands the development of novel therapeutic approaches. One of the proposed approaches has been the down-regulation of BCL2, with poorly clarified and controversial therapeutic value regarding SCLC. The use of anti-BCL2 small interfering RNA (siRNA) in SCLC has never been reported. The aim of the present study was to select and test the in vitro efficacy of anti-BCL2 siRNA sequences against the protein and mRNA levels of SCLC cells, and their effects on cytotoxicity and chemosensitization. Two anti-BCL2 siRNAs and the anti-BCL2 G3139 oligodeoxynucleotide (ODN) were evaluated in SCLC cells by the simultaneous determination of Bcl-2 and viability using a flow cytometry method recently developed by us in addition to Western blot, real-time reverse-transcription PCR, and cell growth after single and combined treatment with cisplatin. In contrast to previous reports about the use of ODN, a heterogeneous and up to 80% sequence-specific Bcl-2 protein knockdown was observed in the SW2, H2171 and H69 SCLC cell lines, although without significant sequence-specific reduction of cell viability, cell growth, or sensitization to cisplatin. Our results question previous data generated with antisense ODN and supporting the present concept of the therapeutic interest in BCL2 silencing per se in SCLC, and support the growing notion of the necessity of a multitargeting molecular approach for the treatment of cancer.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.