43 resultados para ATOPIC DERMATITIS
em Scielo Saúde Pública - SP
Resumo:
OBJETIVO: Analisar as propriedades psicométricas iniciais da versão brasileira de instrumento de avaliação da qualidade de vida relacionada à saúde de crianças e adolescentes com dermatite atópica. MÉTODOS: Estudo transversal realizado com amostra de 52 crianças e adolescentes, com idades entre oito e 18 anos, diagnosticados com dermatite atópica, e seus responsáveis, recrutados em serviço de dermatologia de hospital universitário na cidade de São Paulo, SP, em 2009. Foram avaliadas a validade de construto, a confiabilidade de consistência interna e a correlação entre as respostas de crianças e adolescentes e seus responsáveis da versão brasileira do Atopic Dermatitis Module (DISABKIDS-ADM). RESULTADOS: A confiabilidade de consistência interna foi satisfatória, com coeficiente alfa de Cronbach aceitável para as dimensões constantes no instrumento (0,7024/0,8124 e 0,7239/0,8604). A análise multitraço-multimétodo para validade convergente mostrou valores maiores que 0,30 para todos os itens. Quanto à validade discriminante, a análise revelou resultados satisfatórios. A concordância entre as versões self e proxy foi avaliada pelo coeficiente de correlação intra-classe, com valores de 0,8173 para impacto e 0,7629 para estigma. CONCLUSÕES: Diante dos resultados encontrados, considera-se que o instrumento DISABKIDS-ADM pode ser utilizado por pesquisadores brasileiros depois de finalizado seu processo de validação, por seus resultados iniciais apontarem propriedades psicométricas satisfatórias, que permitem considerá-lo um instrumento válido e confiável.
Resumo:
INTRODUCTION: Ascaris lumbricoides-infected patients present lower prevalence of severe atopic dermatitis. METHODS: Peripheral blood of infected children with atopic dermatitis was assessed by flow cytometry of the frequency of Th1 and Th2 cells through the expression of CXCR3 and CCR4 chemokine receptors, respectively. RESULTS: Helminth-free patients with atopic dermatitis presented a high frequency of CCR4+Th2 cells. Parasitized patients with atopic dermatitis showed a lower frequency of CXCR3+Th1 cells compared to infected individuals only. CONCLUSIONS: Ascariasis modifies the blood traffic of Th2 cells in atopic dermatitis patients, while the allergic disease down-regulates the traffic of Th1 cells in parasitized patients.
Resumo:
O objetivo deste estudo foi traduzir e adaptar culturalmente para o Brasil o DISABKIDS® Atopic Dermatitis Module (ADM), instrumento para mensuração de qualidade de vida relacionada à saúde de crianças e adolescentes, com Dermatite Atópica. O instrumento possui 12 itens com respostas em escala do tipo Likert, com duas versões, self e proxy. A pesquisa incluiu uma amostra de 18 crianças e adolescentes brasileiros com Dermatite Atópica, na faixa etária de 8 a 18 anos, e seus respectivos pais ou cuidadores. O processo envolveu as fases de tradução-retrotradução e validação semântica. A validação semântica mostrou boa aceitação da versão traduzida do instrumento com fácil compreensão de seus itens pelos participantes. Após o término de seu processo de validação no país, o instrumento poderá ser utilizado por pesquisadores brasileiros para mensuração de qualidade de vida relacionada à saúde, bem como possibilitará comparação entre resultados no Brasil com outras culturas nas quais o instrumento já se encontra validado.
Resumo:
House dust mite antigens have been used for decades to diagnose allergic diseases in humans and animals. The objective of this study was to identify allergens in commercial Dermatophagoides farinae and Blomia tropicalis extracts by immunoblotting using sera from allergic dogs and anti-dog IgE conjugate. The analysis of antigens present in the D. farinae extract (FDA Allergenic) using sera from 10 dogs allergic to D. farinae showed that eight sera recognized a band of approximately 102 kDa, eight recognized two bands of 52 to 76 kDa, five recognized one band of approximately 76 kDa, four recognized one band of 31 to 38 kDa, and two recognized one band of 12 to 17 kDa. Immunoblot assays of the B. tropicalis extract (FDA Allergenic) using sera from 10 animals allergic to B. tropicalis showed that five sera recognized two bands of 52 to 76 kDa. These results demonstrate the importance of the two house dust mite species for the pathogenesis of canine atopic dermatitis in Brazil. In addition, the results indicate which allergens should be present in allergenic extracts used for diagnosis and allergen-specific immunotherapy.
Resumo:
Staphylococcus aureus is highly prevalent among patients with atopic dermatitis (AD), and this pathogen may trigger and aggravate AD lesions. The aim of this study was to determine the prevalence of S. aureus in the nares of pediatric subjects and verify the phenotypic and molecular characteristics of the isolates in pediatric patients with AD. Isolates were tested for antimicrobial susceptibility, SCCmectyping, and Panton-Valentine Leukocidin (PVL) genes. Lineages were determined by pulsed-field gel electrophoresis and multilocus sequence typing (MLST). AD severity was assessed with the Scoring Atopic Dermatitis (SCORAD) index. Among 106 patients, 90 (85%) presented S. aureus isolates in their nares, and 8 also presented the pathogen in their skin infections. Two patients had two positive lesions, making a total of 10 S. aureusisolates from skin infections. Methicillin-resistant S. aureus(MRSA) was detected in 24 (26.6%) patients, and PVL genes were identified in 21 (23.3%), including 6 (75%) of the 8 patients with skin lesions but mainly in patients with severe and moderate SCORAD values (P=0.0095). All 24 MRSA isolates were susceptible to trimethoprim/sulfamethoxazole, while 8 isolates had a minimum inhibitory concentration (MIC) to mupirocin >1024 μg/mL. High lineage diversity was found among the isolates including USA1100/ST30, USA400/ST1, USA800/ST5, ST83, ST188, ST718, ST1635, and ST2791. There was a high prevalence of MRSA and PVL genes among the isolates recovered in this study. PVL genes were found mostly among patients with severe and moderate SCORAD values. These findings can help clinicians improve the therapies and strategies for the management of pediatric patients with AD.
Resumo:
The objective of the study was to evaluate whether allergenic extracts of five house dust and storage mite species standardized for humans might be used for the diagnosis of canine atopic dermatitis (CAD). Extracts of Dermatophagoides pteronyssinus (Pyroglyphidae), D. farinae (Pyroglyphidae), Blomia tropicalis (Glycyphagidae), Lepidoglyphus destructor (Glycyphagidae) and Tyrophagus putrescentiae (Acaridae) were evaluated by intradermal testing in 20 healthy dogs (control) and 25 dogs with allergic dermatitis. A significant difference in the response was observed between the two groups (p<0.05). Only one dog (5%) in the control group reacted to the intradermal test, whereas 14 dogs (56%) in the allergic group were positive for at least one extract (odds ratio = 24.2). Most of the positive reactions observed in the allergic group occurred against the extracts of T. putrescentiae or L. destructor, each inducing reactions in 10 dogs (40%). D. farinae, D. pteronyssinus e B. tropicalis extracts induced reactions in 7 (28%), 3 (12%) and 3 (12%) dogs, respectively. The allergenic extracts standardized for humans evaluated in the present study may be used as a tool to complement the diagnosis of the disease, as well as to select potential allergen candidates for allergen-specific immunotherapy.
Resumo:
Parasitic infection is highly allergenic, and the present paper illustrates how parasites might disrupt the regulation of IgE synthesis, resulting in heightened Th-2 responses. The study of parasites, and dysregulation of the IgE ntwork, could in turn provide information relating to the aetiology of allergic diseases such as asthma and atopic dermatitis.
Resumo:
Pemphigus is an inflammatory autoimmune disorder of the skin. Nitric oxide (NO) is an inflammatory mediator linked to a variety of physiological and pathophysiological phenomena that include skin tumors, psoriasis, urticaria, and atopic dermatitis. Inflammatory cells present in pemphigus lesions are important sources of NO production. We investigated whether NO is involved in pemphigus. A prospective cohort study was conducted at the Dermatology Service of the Hospital Universitário Walter Cantídio of the Federal University of Ceará. All patients seen at the outpatient clinic between August 2000 and July 2001, with a clinically and histologically confirmed diagnosis of pemphigus were included. The median age was 42.5 years (range: 12-69 years) with a male to female ratio of 3:2. Total serum nitrite levels, used as a marker for NO production, were determined by the Griess reaction. Skin biopsies from pemphigus and breast surgery (control) patients were used for the detection of the inducible NO synthase (iNOS) by immunohistochemistry. Twenty-two (22) patients with pemphigus and eight (8) controls who did not differ in demographic characteristics were included. Total serum nitrite levels were significantly higher (>7 µmol/L) in pemphigus patients compared to controls (<6 µmol/L), regardless of the severity of the clinical activity of pemphigus (P < 0.0001). All pemphigus biopsies presented increased immunostaining for iNOS that was not detected in normal skin samples. These data are the first to demonstrate that pemphigus patients display increased serum NO levels that are associated with increased iNOS expression in the affected skin.
Resumo:
Crude extracts of house dust mites are used clinically for diagnosis and immunotherapy of allergic diseases, including bronchial asthma, perennial rhinitis, and atopic dermatitis. However, crude extracts are complexes with non-allergenic antigens and lack effective concentrations of important allergens, resulting in several side effects. Dermatophagoides farinae (Hughes; Acari: Pyroglyphidae) is one of the predominant sources of dust mite allergens, which has more than 30 groups of allergen. The cDNA coding for the group 5 allergen of D. farinae from China was cloned, sequenced and expressed. According to alignment using the VECTOR NTI 9.0 software, there were eight mismatched nucleotides in five cDNA clones resulting in seven incompatible amino acid residues, suggesting that the Der f 5 allergen might have sequence polymorphism. Bioinformatics analysis revealed that the matured Der f 5 allergen has a molecular mass of 13604.03 Da, a theoretical pI of 5.43 and is probably hydrophobic and cytoplasmic. Similarities in amino acid sequences between Der f 5 and allergens of other domestic mite species, viz. Der p 5, Blo t 5, Sui m 5, and Lep d 5, were 79, 48, 53, and 37%, respectively. Phylogenetic analysis indicated that Der f 5 and Der p 5 clustered together. Blo t 5 and Ale o 5 also clustered together, although Blomia tropicalis and Aleuroglyphus ovatus belong to different mite families, viz. Echimyopodidae and Acaridae, respectively.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
This work consists in an evaluation of the occurrence of nickel contact dermatitis, its distribution between sexes and in which parts of the body the dermatitis usually occurs. It was accomplished a two year (1994-1995) retrospective study of 404 patch-tested patients which had previous clinical diagnosis of contact dermatitis. The occurrence of nickel sensitisation was 19,8%. 88,8% of these 19,8% were women and the rest, 11,2%, were men. The lesions were present predominantly on hands, forearms, earlobes and feet. The authors comment about possible variations of occurrence of nickel contact dermatitis in rural areas and/or tropical countries
Resumo:
Nowadays 70% of the world's rubber supply is synthesized artificially. The process involved in its manufacture is vulcanization which requires many chemical substances for speeding the process, as antioxidants to prevent deterioration of rubber, or others. These substances may constitute important sensitizers and thus be responsible for dermatological diseases like contact dermatitis. The objective of this study is to search for the main sensitizers among these rubber chemicals in a population mostly composed by women of a tropical country and compare the results with the ones obtained from previous studies which tested populations mainly composed by men and on different climates.
Resumo:
Abstract: We herein report human dermatitis caused by the tropical fowl mite Ornithonyssus bursa (Berlese). The cases occurred in an apartment in a residential district of Porto Alegre City, State of Rio Grande do Sul, Brazil, where three members of the same family presented with pruritic lesions on the arms and legs. On inspecting the bathroom, several mites measuring approximately 1.0mm in length were observed coming from a nest of Rufous Hornero, Furnarius rufus (Gmelin). This is the first report of O. bursa in the urban area of Porto Alegre City, from a nest of F. rufus that bites humans.
Resumo:
Congenitally athymic nude Balb/c (nu/nu) and their phenothypically normal adult and neonate littermates (nu/+), the C3H/HeN as well, were intraperitoneally infected with two strains (Y or CL) of Trypanossoma cruzi. The nude mice and the neonates developed a severe parasitaemia, the susceptible C3H/HeN also presented high level and adult Balb/c mice presented parasitaemia similar to that observed in outbred mice. Erythematous skin lesions were observed initially in infected athymic nude and neonates, being charactherized by nests of amastigotes in the dermis; in C3H/HeN infected mice no nest of parasite was observed but a low-grade inflammatory reaction was seen. In adult Balb/c or OF1 outbred mice nest was found but discreet inflammatory reaction was observed in severe infections.
Resumo:
This report characterizes the digital dermatitis (DD) lesions in the accessory digits of dairy cows and presents data on the applied therapy. Fifteen Holstein cattle with DD affecting the accessory digits of the hindlimbs from four dairy farms with previous history of DD were evaluated. Lesions were excised, the wounds were sutured, and a topical application of oxytetracycline powder covered by bandaging was associated with a single parenteral administration of long acting oxytetracycline IM (20mg/kg). Tissue samples were obtained for histopathology and transmission electronic microscopy (TEM). Lesions from all the animals were recuperated 15 days after surgical procedure. Overal, most DD lesions were papillomatous epidermal projections or wartlike verrucous lesions. Histopathologically, samples revealed hyperplasia of epidermis with hyperkeratosis, several mitoses in the stratum basale and elongated rete ridges in the superficial and middle dermis. TEM revealed long, thin spirochete-like bacteria. Morphologic features of lesions and its response to therapy were comparable to those described for DD.