141 resultados para conduction bands


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Description and phylogenetic analysis of the Calycopidina (Lepidoptera, Lycaenidae, Theclinae, Eumaeini): a subtribe of detritivores. The purpose of this paper is to establish a phylogenetic basis for a new Eumaeini subtribe that includes those lycaenid genera in which detritivory has been recorded. Morphological characters were coded for 82 species of the previously proposed "Lamprospilus Section" of the Eumaeini (19 of these had coding identical to another species), and a phylogenetic analysis was performed using the 63 distinct ingroup terminal taxa and six outgroups belonging to four genera. Taxonomic results include the description in the Eumaeini of Calycopidina Duarte & Robbins new subtribe (type genus Calycopis Scudder, 1876), which contains Lamprospilus Geyer, Badecla Duarte & Robbins new genus (type species Thecla badaca Hewitson), Arzecla Duarte & Robbins new genus (type species Thecla arza Hewitson), Arumecla Robbins & Duarte, Camissecla Robbins & Duarte, Electrostrymon Clench, Rubroserrata K. Johnson & Kroenlein revalidated status, Ziegleria K. Johnson, Kisutam K. Johnson & Kroenlein revalidated status, and Calycopis. Previous "infratribe" names Angulopina K. Johnson & Kroenlein, 1993, and Calycopina K. Johnson & Kroenlein, 1993, are nomenclaturally unavailable and polyphyletic as proposed. New combinations include Badecla badaca (Hewitson), Badecla picentia (Hewitson), Badecla quadramacula (Austin & K. Johnson), Badecla lanckena (Schaus), Badecla argentinensis (K. Johnson & Kroenlein), Badecla clarissa (Draudt), Arzecla arza (Hewitson), Arzecla tarpa (Godman & Salvin), Arzecla canacha (Hewitson), Arzecla calatia (Hewitson), Arzecla tucumanensis (K. Johnson & Kroenlein), Arzecla sethon (Godman & Salvin), Arzecla nubilum (H. H. Druce), Arzecla paralus (Godman & Salvin), Arzecla taminella (Schaus), Arzecla albolineata (Lathy), Electrostrymon denarius (Butler & H.Druce), Electrostrymon guzanta (Schaus), Electrostrymon perisus (H. H. Druce), Rubroserrata mathewi (Hewitson), Rubroserrata ecbatana (Hewitson), Kisutam micandriana (K. Johnson), and Kisutam syllis (Godman & Salvin). The structure of the male genitalia lateral window, labides, and brush organs are described and discussed, as are the female genitalia signa of the corpus bursae and 8th abdominal tergum. Widespread wing pattern sexual dimorphism in the Calycopidina is noted and illustrated, and the presence of alternating dark and light bands on the ventral wings of both sexes is discussed. The evidence for detritivory in Lamprospilus, Badecla, Arzecla, Arumecla, Camissecla, Electrostrymon, Ziegleria, Kisutam, and Calycopis is summarized using the new classification.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

During timber exploitation in forest stands harvesting machines pass repeatedly along the same track and can cause soil compaction, which leads to soil erosion and restricted tree root growth. The level of soil compaction depends on the number of passes and weight of the wood load. This paper aimed to evaluate soil compaction and eucalyptus growth as affected by the number of passes and wood load of a forwarder. The study was carried out in Santa Maria de Itabira county, Minas Gerais State - Brazil, on a seven-year-old eucalyptus stand planted on an Oxisol. The trees were felled by chainsaw and manually removed. Plots of 144 m² (four rows 12 m long in a 3 x 2 m spacing) were then marked off for the conduction of two trials. The first tested the traffic intensity of a forwarder which weighed 11,900 kg and carried 12 m³ wood (density of 480 kg m-3) and passed 2, 4, and 8 times along the same track. In the second trial, the forwarder carried loads of 4, 8, and 12 m³ of wood, and the machine was driven four times along the same track. In each plot, the passes affected four rows. Eucalyptus was planted in 30 x 30 x 30 cm holes on the compacted tracks. The soil in the area is clayey (470 clay and 440 g kg-1 sand content) and at depths of 0-5 cm and 5-10 cm, respectively, soil organic carbon was 406 and 272 g kg-1 and the moisture content during the trial 248 and 249 g kg-1. These layers were assessed for soil bulk density and water-stable aggregates. The infiltration rate was measured by a cylinder infiltrometer. After 441 days the measurements were repeated, with additional analyses of: soil organic carbon, total nitrogen, N-NH4+, N-NO3-, porosity, and penetration resistance. Tree height, stem diameter, and stem dry matter were measured. Forwarder traffic increased soil compaction, resistance to penetration and microporosity while it reduced the geometric mean diameter, total porosity, macroporosity and infiltration rate. Stem dry matter yield and tree height were not affected by soil compaction. Two passes of the forwarder were enough to cause the disturbances at the highest levels. The compaction effects were still persistent 441 days after forwarder traffic.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

It is well-known that Amazon tropical forest soils contain high microbial biodiversity. However, anthropogenic actions of slash and burn, mainly for pasture establishment, induce profound changes in the well-balanced biogeochemical cycles. After a few years the grass yield usually declines, the pasture is abandoned and is transformed into a secondary vegetation called "capoeira" or fallow. The aim of this study was to examine how the clearing of Amazon rainforest for pasture affects: (1) the diversity of the Bacteria domain evaluated by Polymerase Chain Reaction and Denaturing Gradient Gel Electrophoresis (PCR-DGGE), (2) microbial biomass and some soil chemical properties (pH, moisture, P, K, Ca, Mg, Al, H + Al, and BS), and (3) the influence of environmental variables on the genetic structure of bacterial community. In the pasture soil, total carbon (C) was between 30 to 42 % higher than in the fallow, and almost 47 % higher than in the forest soil over a year. The same pattern was observed for N. Microbial biomass in the pasture was about 38 and 26 % higher than at fallow and forest sites, respectively, in the rainy season. DGGE profiling revealed a lower number of bands per area in the dry season, but differences in the structure of bacterial communities among sites were better defined than in the wet season. The bacterial DNA fingerprints in the forest were stronger related to Al content and the Cmic:Ctot and Nmic:Ntot ratios. For pasture and fallow sites, the structure of the Bacteria domain was more associated with pH, sum of bases, moisture, total C and N and the microbial biomass. In general microbial biomass in the soils was influenced by total C and N, which were associated with the Bacteria domain, since the bacterial community is a component and active fraction of the microbial biomass. Results show that the genetic composition of bacterial communities in Amazonian soils changed along the sequence forest-pasture-fallow.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Reflectance, emissivity and elevation data of the sensor ASTER (Advanced Spaceborne Thermal Emission and Reflection Radiometer)/Terra were used to characterize soil composition variations according to the toposequence position. Normalized data of SWIR (shortwave infrared) reflectance and TIR (thermal infrared) emissivity, coupled to a soil-fraction image from a spectral mixture model, were evaluated to separate bare soils from nonphotosynthetic vegetation. Regression relationships of some soil properties with reflectance and emissivity data were then applied on the exposed soil pixels. The resulting estimated values were plotted on the ASTER-derived digital elevation model. Results showed that the SWIR bands 5 and 6 and the TIR bands 10 and 14 measured the clay mineral absorption band and the quartz emissivity feature, respectively. These bands improved also the discrimination between nonphotosynthetic vegetation and soils. Despite the differences in pixel size and field sampling size, some soil properties were correlated with reflectance (R² of 0.65 for Al2O3 in band 6; 0.61 for Fe2O3 in band 3) and emissivity (R² of 0.65 for total sand fraction in the 10/14 band ratio). The combined use of reflectance, emissivity and elevation data revealed variations in soil composition with topography in specific parts of the landscape. From higher to lower slope positions, a general decrease in Al2O3 and increase in total sand fraction was observed, due to the prevalence of Rhodic Acrustox at the top and its gradual transition to Typic Acrustox at the bottom.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The study of the ecology of soil microbial communities at relevant spatial scales is primordial in the wide Amazon region due to the current land use changes. In this study, the diversity of the Archaea domain (community structure) and ammonia-oxidizing Archaea (richness and community composition) were investigated using molecular biology-based techniques in different land-use systems in western Amazonia, Brazil. Soil samples were collected in two periods with high precipitation (March 2008 and January 2009) from Inceptisols under primary tropical rainforest, secondary forest (5-20 year old), agricultural systems of indigenous people and cattle pasture. Denaturing gradient gel electrophoresis of polymerase chain reaction-amplified DNA (PCR-DGGE) using the 16S rRNA gene as a biomarker showed that archaeal community structures in crops and pasture soils are different from those in primary forest soil, which is more similar to the community structure in secondary forest soil. Sequence analysis of excised DGGE bands indicated the presence of crenarchaeal and euryarchaeal organisms. Based on clone library analysis of the gene coding the subunit of the enzyme ammonia monooxygenase (amoA) of Archaea (306 sequences), the Shannon-Wiener function and Simpson's index showed a greater ammonia-oxidizing archaeal diversity in primary forest soils (H' = 2.1486; D = 0.1366), followed by a lower diversity in soils under pasture (H' = 1.9629; D = 0.1715), crops (H' = 1.4613; D = 0.3309) and secondary forest (H' = 0.8633; D = 0.5405). All cloned inserts were similar to the Crenarchaeota amoA gene clones (identity > 95 %) previously found in soils and sediments and distributed primarily in three major phylogenetic clusters. The findings indicate that agricultural systems of indigenous people and cattle pasture affect the archaeal community structure and diversity of ammonia-oxidizing Archaea in western Amazon soils.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Studies have proven that the agroforestry systems in the semi-arid region of the State of Ceará, Brazil, induce an increase in soil organic C levels. Notwithstanding, there is no information if this increase also results in qualitative changes in different pools of soil organic matter. The objective of this study was to verify the possible chemical and structural alterations in fulvic and humic acids of a Luvisol in areas adopting agroforestry, traditional intensive cultivation and native forest in a long-term experiment conducted in the semi-arid region of Ceará State, Brazil. The study was conducted in an experimental area of the National Goat Research Center (Embrapa) in Sobral, CE. The following treatments were evaluated: agrosilvopasture (AGP), silvopasture (SILV), intensive cultivation under fallow (ICF), and areas with native forest (NF). Soil fulvic and humic acids fractions were extracted from the 0-6 and 6-12 cm layers and characterized by elemental composition, thermogravimetry and infrared spectroscopy analyses. The elemental composition analysis of humic acids confirmed the data found for fulvic acids, showing reduction in the C, H and N levels, followed by an increase in O contents in the AGP and ICF treatments over SILV and NF. In all treatments, except to SILV in the 0-6 cm layer, the percentage of mass loss was highest (300-600 °C) for humic acids in the thermally most stable region. Despite the similarity between infrared spectra, soil fulvic acids in the SILV treatment extracted from 6-12 cm depth decrease the absorption bands at 1708 and 1408 cm-1 followed by an increase in the absorption band at 1608 cm-1 attributed to aromatic C=C groups. This behavior suggests an increase in the aromatic character of the structure. The AGP and ICF treatments, which increase the soil tilling, favored the maintenance of humic substances with a more aromatic character in the soil than SILV and NF. The less aromatic humic substances in the SILV treatment resulted in an increase of exchange sites of soil organic matter, indicating improved nutrient cycling and maintenance of productivity in the system.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

An in vitro system for studying the resistance response of cotton (Gossypium hirsutum L.) to Xanthomonas campestris pv. malvacearum was investigated. Cell suspension cultures, established from hypocotyl-derived callus of cotton cultivar 101-102B, were treated with bacterial extracellular polysaccharides (EPS) extracted from the incompatible race 18 of X. campestris pv. malvacearum. EPS at 600 mug/mL caused pronounced darkening of the suspension cultures, as indicative of cell death, 48 hours after incubation. Protein electrophoresis analysis of the time course of EPS-treated cells showed differential accumulation of several protein bands after 12-24 hours. The time course of protein accumulation and cell death was consistent with an elicitor-mediated hypersensitive response.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Since there is evidence that malting quality is related to the storage protein (hordein) fraction, in the present work the hordein polypeptide patterns from 13 barley (Hordeum vulgare L.) varieties of different malting quality were analysed in order to explore the feasibility of using hordein electrophoresis to assist in the selection of malting barleys. The formation of clusters separating the varieties with higher malting quality from the others with lower quality suggests that there is a relationship between the general hordein polypeptide pattern and malting quality in the varieties analysed. By the Sperman's correlation test three hordein bands correlated negatively with malting quality in the germplasm studied.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this work was to verify if reflected energy of soils can characterize and discriminate them. A spectroradiometer (Spectral reflectance between: 400-2,500 nm) was utilized in laboratory. The soils evaluated are located in Bauru region, SP, Brazil, and are classified as Typic Argiudoll (TR), Typic Eutrorthox (LR), Typic Argiudoll (PE), Typic Haplortox (LE), Typic Paleudalf (PV) and Typic Quartzipsamment (AQ). They were characterized by their spectral reflectance as for descriptive conventional methods (Brazilian and International) according to the types of spectral curves. A method for the spectral descriptive evaluation of soils was established. It was possible to characterize and discriminate the soils by their spectral reflectance, with exception for LR and TR. The spectral differences were better identified by the general shape of spectral curves, by the intensity of band absorption and angle tendencies. These characteristics were mainly influenced by organic matter, iron, granulometry and mineralogy constituents. A reduction of iron and clay contents, which influenced higher reflectance intensity and shape variations, occurred on the soils LR/TR, PE, LE, PV and AQ, on that sequence. Soils of the same group with different clay textures could be discriminated. The conventional descriptive evaluation of spectral curves was less efficient on discriminating soils. Simulated orbital data discriminated soils mainly by bands 5 and 7.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae var. acridum, strain CG 423, was tested under field conditions against the gregarious grasshopper Rhammatocerus schistocercoides (Rehn) (Orthoptera: Acrididae). Conidia formulated in a racemic mixture of soybean oil and kerosene were sprayed under field conditions using an ultralow-volume hand-held atomizer Ulva Plus adjusted to deliver 2.9 L/ha. Bands composed of 2nd instar nymphs were treated with either 5.0x10(12) or 1.0x10(13) viable conidia/ha. The number of insects in each band was estimated at day one following spraying and by the end of the field trial (15 to 16 days post-treatment). Reductions in population size reached, in average, 65.8% and 80.4% for bands treated with the higher and lower dosage, respectively. For both dosages, total mortality rates of insects collected at two days post-application, and kept in cages for 14 days under lab conditions, showed no significant differences as compared to that obtained with insects collected immediately after spraying. Healthy insects were fed to native grasses sprayed on the field with 1.0x10(13) viable conidia/ha. Mortality levels of the nymphs fed on grasses collected two and four days post-application were not affected when compared to nymphs fed on grasses collected immediately following application.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Rice blast is a major yield constraint of the irrigated rice in the State of Tocantins, Brazil. The objective of this investigation was to study the phenotypic and genetic diversity within the pathogen population of Pyricularia grisea in samples collected from four individual farms of rice cultivar Metica-1, under epidemic conditions of leaf blast. A set of 87 isolates was tested on 32 rice genotypes including eight international differentials. Considering 80% similarity in virulence, two groups comprising a total of 81 isolates were recognized, independently of the farms from which they were collected. Eighty percent of the isolates pertained to pathotype ID-14, indicating high cultivar specificity and narrow diversity of virulence in the sample population. The virulence in pathogen population on rice cultivars BR-IRGA 409 and Rio Formoso was low. Analysis of P. grisea isolates using rep-PCR with two primer sequences from Pot2 generated fingerprint profiles of one to nine bands. Cluster analysis revealed the occurrence of six fingerprint groups with similarities ranging from 0.09 to 1. There was no straight relationship between virulence of the isolates based on reaction pattern on 32 genotypes and grouping based on Pot2 rep-PCR analysis of P. grisea isolates collected from 'Metica-1'.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In order to detect fluctuations in ruminal microbial populations due to forage tannins using 16S ribosomal RNA (rRNA) probes, recovery of intact rRNA is required. The objective of this work was to evaluate the effect of polyethylene glycol (PEG) and polyvinylpirrolidone (PVP) on extraction of bacterial rRNA, in the presence of tannins from tropical legume forages and other sources, that hybridize with oligonucleotide probes. Ruminococcus albus 8 cells were exposed to 8 g/L tannic acid or 1 g/L condensed tannins extracted from Acacia angustissima, banana (Musa sp.) skin, Desmodium ovalifolium, red grape (Vitis vinifera) skin and Inga edulis, or no tannins. Cells were rinsed with Tris buffer pH 7 containing either 8% PEG or 6% PVP prior to cell lysis. Total RNA samples rinsed with either PEG or PVP migrated through denaturing agarose gels. The 16S rRNA bands successfully hybridized with a R. albus species-specific oligonucleotide probe, regardless of tannin source. The effect of rinsing buffers on the density of 16S rRNA bands, as well as on the hybridization signals was compared. There were significant effects (P<0.01) when the controls were compared to either buffer treatments due to tannin type, buffer used and the interaction of tannin type and buffer. The significant interaction indicates the influence of tannin type on the parameters evaluated.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Conservation and improvement strategies should be based on the association between genetic and phenotypic characteristics. The objective of this work was to characterize five native Brazilian cattle breeds (Caracu, Crioulo Lageano, Curraleiro, National Polled and Pantaneiro) and two commercial breeds (Holstein and Nellore) using RAPD technique to estimate genetic distances and variability between and within breeds. Genetic relationships were investigated using 22 primers which generated 122 polymorphic bands. Analysis of molecular variance indicated that most of the genetic variation lay among individuals within populations. The genetic variabilities between pairs of breeds were statistically significant. The smallest genetic divergence was between Crioulo Lageano and Curraleiro.The National Polled, although historically considered to be of Bos taurus aquitanicus origin,similar to theCaracu, was grouped together with the other breeds of Bos taurus ibericus origin. Generally, the individual breeds formed distinct clusters except the National Polled. The RAPD technique was capable to distinguish genetically between the breeds studied; the Caracu, Crioulo Lageano, Curraleiro and Pantaneiro may be considered distinct genetic entities thereby proving the uniqueness of the populations; the National Polled has not been able to re-establish itself after its decline in the 1950s, thereby losing its genetic identity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this study was to verify the genetic diversity between and within seven populations of Moxotó goat (n = 264) from the States of Pernambuco, Paraíba and Rio Grande do Norte, using RAPD (Random Amplified Polymorphic DNA). Moxotó, as well as other naturalized breeds, suffers genetic losses due to the indiscriminate miscegenation with breeds raised in the Northeast Region of Brazil. The genetic characterization of these genetic resources is essential to conservation and breeding programs. DNA was extracted from lymphocytes using a non-organic protocol. The 16 primers used were selected from 120 decamer oligonucleotide primers and generated 56 polymorphic bands. The analysis of molecular variance (AMOVA) showed that the greater part of total genetic variability (71.55%) was due to differences between individuals within populations, while 21.21% was among populations. The analysis of variance among the pairs of populations demonstrated that the populations located in Floresta, PE x Angicos, RN presented a smaller value of intrapopulational differentiation (8.9%), indicating low genetic variability among them. Nei's genetic distances varied between 0.0546 and 0.1868 in the populations. The dendrogram generated showed that the Canindé breed, used as outgroup, clustered with the populations of Moxotó, indicating a possible common origin of the naturalized goat breeds.