134 resultados para KERATINOCYTES CULTURE


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The adhesins of extraintestinal pathogenic Escherichia coli are essential for mediating direct interactions between the microbes and the host cell surfaces that they infect. Using fluorescence microscopy and gentamycin protection assays, we observed that 49 sepsis-associated E. coli (SEPEC) strains isolated from human adults adhered to and invaded Vero cells in the presence of D-mannose (100%). In addition, bacteria concentrations of approximately 2 x 10(7) CFU/mL were recovered from Vero cells following an invasion assay. Furthermore, PCR analysis of adhesin genes showed that 98.0% of these SEPEC strains tested positive for fimH, 69.4% for flu, 53.1% for csgA, 38.8% for mat, and 32.7% for iha. Analysis of the invasin genes showed that 16.3% of the SEPEC strains were positive for tia, 12.3% for gimB, and 10.2% for ibeA. Therefore, these data suggest that SEPEC adhesion to cell surfaces occurs through non-fimH mechanisms. Scanning electron microscopy showed the formation of microcolonies on the Vero cell surface. SEPEC invasiveness was also confirmed by the presence of intracellular bacteria, and ultrastructural analysis using electron transmission microscopy revealed bacteria inside the Vero cells. Taken together, these results demonstrate that these SEPEC strains had the ability to adhere to and invade Vero cells. Moreover, these data support the theory that renal cells may be the predominant pathway through which SEPEC enters human blood vessels.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In order to understand the mechanisms of poor osseointegration following dental implants in type 2 diabetics, it is important to study the biological properties of alveolar bone osteoblasts isolated from these patients. We collected alveolar bone chips under aseptic conditions and cultured them in vitro using the tissue explants adherent method. The biological properties of these cells were characterized using the following methods: alkaline phosphatase (ALP) chemical staining for cell viability, Alizarin red staining for osteogenic characteristics, MTT test for cell proliferation, enzyme dynamics for ALP contents, radio-immunoassay for bone gla protein (BGP) concentration, and ELISA for the concentration of type I collagen (COL-I) in the supernatant. Furthermore, we detected the adhesion ability of two types of cells from titanium slices using non-specific immunofluorescence staining and cell count. The two cell forms showed no significant difference in morphology under the same culture conditions. However, the alveolar bone osteoblasts received from type 2 diabetic patients had slower growth, lower cell activity and calcium nodule formation than the normal ones. The concentration of ALP, BGP and COL-I was lower in the supernatant of alveolar bone osteoblasts received from type 2 diabetic patients than in that received from normal subjects (P < 0.05). The alveolar bone osteoblasts obtained from type 2 diabetic patients can be successfully cultured in vitro with the same morphology and biological characteristics as those from normal patients, but with slower growth and lower concentration of specific secretion and lower combining ability with titanium than normal ones.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A dendritic cell (DC)-based vaccine strategy could reduce the risk of recurrence and improve the survival of breast cancer patients. However, while therapy-induced apoptosis of hepatocellular and colorectal carcinoma cells can enhance maturation and antigen presentation of DCs, whether this effect occurs in breast cancer is currently unknown. In the present study, we investigated the effect of doxorubicin (ADM)-induced apoptotic MCF-7 breast cancer cells on the activation of DCs. ADM-induced apoptotic MCF-7 cells could effectively induce immature DC (iDC) maturation. The mean fluorescence intensity (MFI) of DC maturity marker CD83 was 23.3 in the ADM-induced apoptotic MCF-7 cell group compared with 8.5 in the MCF-7 cell group. The MFI of DC co-stimulatory marker CD86 and HLA-DR were also increased after iDCs were treated with ADM-induced apoptotic MCF-7 cells. Furthermore, the proliferating autologous T-lymphocytes increased from 14.2 to 40.3% after incubated with DCs induced by apoptotic MCF-7 cells. The secretion of interferon-γ by these T-lymphocytes was also increased. In addition, cell-cell interaction between apoptotic MCF-7 cells and iDCs, but not soluble factors released by apoptotic MCF-7 cells, was crucial for the maturation of iDCs. These findings constitute a novel in vitro DC-based vaccine strategy for the treatment of breast cancer by ADM-induced apoptotic MCF-7 cells.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Current therapy for pancreatic cancer is multimodal, involving surgery and chemotherapy. However, development of pancreatic cancer therapies requires a thorough evaluation of drug efficacy in vitro before animal testing and subsequent clinical trials. Compared to two-dimensional culture of cell monolayer, three-dimensional (3-D) models more closely mimic native tissues, since the tumor microenvironment established in 3-D models often plays a significant role in cancer progression and cellular responses to the drugs. Accumulating evidence has highlighted the benefits of 3-D in vitro models of various cancers. In the present study, we have developed a spheroid-based, 3-D culture of pancreatic cancer cell lines MIAPaCa-2 and PANC-1 for pancreatic drug testing, using the acid phosphatase assay. Drug efficacy testing showed that spheroids had much higher drug resistance than monolayers. This model, which is characteristically reproducible and easy and offers rapid handling, is the preferred choice for filling the gap between monolayer cell cultures and in vivo models in the process of drug development and testing for pancreatic cancer.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Some clinical isolates of Pseudomonas aeruginosa stored in our culture collection did not grow or grew poorly and showed lysis on the culture plates when removed from the collection and inoculated on MacConkey agar. One hypothesis was that bacteriophages had infected and killed those clinical isolates. To check the best storage conditions to maintain viable P. aeruginosa for a longer time, clinical isolates were stored at various temperatures and were grown monthly. We investigated the presence of phage in 10 clinical isolates of P. aeruginosa stored in our culture collection. Four strains of P. aeruginosa were infected by phages that were characterized by electron microscopy and isolated to assess their ability to infect. The best condition to maintain the viability of the strains during storage was in water at room temperature. Three Siphoviridae and two Myoviridae phages were visualized and characterized by morphology. We confirmed the presence of bacteriophages infecting clinical isolates, and their ability to infect and lyse alternative hosts. Strain PAO1, however, did not show lysis to any phage. Mucoid and multidrug resistant strains of P. aeruginosa showed lysis to 50% of the phages tested.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Follicle cultures reproduce in vitro the functional features observed in vivo. In a search for an ideal model, we cultured bovine antral follicle wall sections (FWS) in a serum-free defined medium (DM) known to induce 17β-estradiol (E2) production, and in a nondefined medium (NDM) containing serum. Follicles were sectioned and cultured in NDM or DM for 24 or 48 h. Morphological features were determined by light microscopy. Gene expression of steroidogenic enzymes and follicle-stimulating hormone (FSH) receptor were determined by RT-PCR; progesterone (P4) and E2 concentrations in the media were measured by radioimmunoassay. DM, but not NDM, maintained an FWS morphology in vitro that was similar to fresh tissue. DM also induced an increase in the expression of all steroidogenic enzymes, except FSH receptor, but NDM did not. In both DM and NDM, there was a gradual increase in P4 throughout the culture period; however, P4 concentration was significantly higher in NDM. In both media, E2 concentration was increased at 24 h, followed by a decrease at 48 h. The E2:P4 ratio was higher in DM than in NDM. These results suggest that DM maintains morphological structure, upregulates the expression of steroidogenic enzyme genes, and maintains steroid production with a high E2:P4 ratio in FWS cultures.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Polygalacturonase production by the thermophilic Bacillus sp. SMIA-2 cultivated in liquid cultures containing 0.5% (w/v) apple pectin and supplemented with 0.3% (w/v) corn steep liquor, reached its maximum after 36 hours with levels of 39 U.mL-1. The increase in apple pectin and corn steep liquor concentrations in the medium from 0.5 and 0.3%, respectively, to 0.65%, markedly affected the production of polygalacturonase, whose activity increased four times, reaching a maximum of 150.3 U.mL-1. Studies on polygalacturonase characterization revealed that the optimum temperature of this enzyme was between 60-70 °C. Thermostability profile indicated that the enzyme retained about 82 and 63% of its activity at 60 and 70 °C, respectively, after 2 hours of incubation. The optimum pH of the enzyme was found to be 10.0. After incubation of crude enzyme solution at room temperature for 2 hours at pH 8.0, a decrease of about 29% on its original activity was observed. At pH 10.0, the decrease was 25%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Halotolerant or halophilic (Archaeabacteria) microorganisms can be found in salted and ripening fish products that are not affected by salt. They can be moderate or extremely halophilic bacteria. The extremely halophilic bacteria require between 15-30% of NaCl for growth. The extremely halophilic archaeobacteria may be selectively isolated in different media. The aim of this work was to determine the effectiveness of the Salt-Agar-Milk medium, a medium modified in our laboratory through the addition of MgSO4 and KCl - named SAMm, and its effect on the bacterial growth by means of comparison with other media, with and without milk, determining time of incubation and counting. Two samples of salted fish from local fish salting factories and two laboratory strains were used. The factory samples were matured anchovy and anchovy fillets in oil, and the laboratory strains were: Haloarcula spp. (proteolytic) and Halococcus spp. (non-proteolytic). The following media were alternatively used for the isolation of extremely halophilic bacteria: IRAM; Formulation of Gibbons and collaborators, Cod Milk agar, and SAMm. IRAM and Gibbons were also used enriched with milk. In the SAMm medium, there were obtained count values similar or higher than the ones of the traditional media; besides the simplicity of its elaboration, the possibility to obtain positive results two or three days earlier also added to its benefit. Consequently, it can be considered an alternative to the media traditionally used for the studied halophilic bacteria.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present work was to evaluate the capacity of three isolates of Aspergillus flavus to produce aflatoxin under different culture conditions. This experiment was based on a 2³ factorial design, in which the independent variables were temperature (20-40 °C), incubation time (7-21 days), and the pH (2.0-6.0) in two different synthetic media. The optimal conditions were applied to non-aflatoxigenic isolates previously tested in coconut agar. Aflatoxin B1 was extracted directly from the synthetic cultures with chloroform. Thin Layer Chromatography (TLC) and Photographic Photometry were utilized to identify and quantify the compounds. Preliminary results showed that YES agar was an alternative medium for detecting the toxigenic potential of Aspergillus flavus in the following conditions: pH of 5.2, temperature of 25 °C, and incubation time of 11 days producing 206.05 ng.CFU-1 of aflatoxin B1. Of the 30 non-aflatoxigenic isolates, 12 presented a positive result in the optimal media and conditions tested.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Protease and α-amylase production by a thermophilic Bacillus sp. SMIA-2 cultivated in liquid cultures containing 0.25% (w/v) starch as a carbon source reached a maximum at 18 hours (47 U.mg-1 Protein) and 36 hours (325 U.mg-1 Protein), respectively. Culture medium supplementation with whey protein concentrate (0.1%, w/v) and corn steep liquor (0.3%, w/v) not only improved the production of both enzymes but also enabled them to be produced simultaneously. Under these conditions, α-amylase and protease production reached a maximum in 18 hours with levels of 401 U.mg-1 protein and 78 U.mg-1 protein, respectively. The compatibility of the enzymes produced with commercial laundry detergent was investigated. In the presence of Campeiro® detergent, α-amylase activity increased while protease activity decreased by about 27%. These enzymes improved the cleaning power of Campeiro® detergent since they were able to remove egg yolk and tomato sauce stains when used in this detergent.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The effect of inulin addition and starters (Kefir grains or commercial starter culture) on the microbial viability, texture, and chemical characteristics of Kefir beverages prepared with whole or skim milk was evaluated during refrigerated storage. The type of starter did not influence microbial viability during the storage of the beverages, but the chemical and textural changes (decreases in pH, lactose concentration, and inulin and increased acidity, firmness, and syneresis) were more pronounced in the formulations fermented with grains than those fermented with the starter culture. The addition of inulin did not influence acidity or viability of lactic acid bacteria, but in general, its effect on the survival of acetic acid bacteria, Lactococcus and yeasts, firmness, and syneresis depended on the type of milk and starter culture used. Generally, the yeast, acetic acid bacteria, and Leuconostoc counts increased or remained unchanged, while the total population of lactic acid bacteria and Lactococcus were either reduced by 1 to 2 logs or remained unchanged during storage.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this research, the probiotic Streptococcus thermophilus was inoculated into milk as co-culture to produce probiotic cheese. The effects of using Streptococcus thermophilus with other probiotic bacteria on cheese composition, and microbiological viability during 28 days of storage were investigated. Sensorial properties were determined only at 1st and 28th days of storage. The results showed that the use of Streptococcus thermophilus as co-culture in probiotic cheese production did not affect negatively the cheese components. Fat and dry matter properties of cheese weren't influenced by added probiotic bacteria. However, different level of pH, salt and lactic acid were detected. All probiotic bacteria were present in high levels throughout storage of cheeses, above 7 Log cfu.g- 1, threshold required for probiotic activity. Sensory panel showed that the highest average sensory evaluation points were recorded in cheeses made with Streptococcus thermophilus plus Lactobacillus casei, whereas other probiotic bacteria combinations had been affected less in regard to taste or appearance.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In biotechnological processes, the culture media components are responsible for high costs and exert a strong influence on the cyanobacteria behavior. The objective of this study was to evaluate the Arthrospira platensis growth potential for biomass production under different cultivation conditions using an experimental design. Three factors that are important for cyanobacteria growth were evaluated: sodium bicarbonate (9 to 18 g/l), sodium nitrate (1.25 to 2.5 g/l), and irradiance (20 to 120 µmol photons/m2.s–1). The results showed that the concentration of NaNO3 in the A. platensis medium can be reduced, resulting in increased concentrations of biomass produced. There was a higher biomass production due to the increase in the concentration of NaHCO3 and irradiance, mainly when these two factors varied tending towards the highest values studied. The results demonstrate the potential to produce Arthrospira platensis with lower costs and effluent generation without affecting cultivation performance.