132 resultados para Gamma-interferon


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present study was to determine the presence of hepatic iron overload in patients with chronic HCV infection and to correlate it with histologic alterations, HCV genotype and response to therapy. Liver tissue samples from 95 patients with chronic hepatitis C were divided into two groups: group I, presence of iron overload in hepatic tissue (Perls' staining) and group II, no iron overload. Hepatic iron overload was detected in 30 (31.6%) of 95 patients. Of the 69 patients tested by genotyping, 49 (71.01%) were genotype 1 and 20 (28.99%) genotype non-1. Iron overload was detected in 14 (28.6%) patients with genotype 1 and in 6 (30%) with genotype non-1 (P = 0.906). There was a significant difference in fibrosis stage between groups (P = 0.005). In group I (N = 30), one patient had stage F0/F1 of fibrosis, while in group II (N = 65), 22 (33.8%) patients had minimal or no fibrosis. Fibrosis stage F2/F3 was observed in 70% of group I patients compared to 46.2% of group II. Eighty-five patients were treated with a combination of interferon and ribavirin; 29 of them (34.1%) had a sustained virologic response and 8 (27.6%) of them had hepatic iron overload. Iron overload was detected in 18 (32.1%) of the 56 non-responders (P = 0.73). Hepatic iron overload was frequent among patients with chronic hepatitis C and was associated with a more severe stage of liver fibrosis. There was no association between iron overload and HCV genotype and response to interferon and ribavirin therapy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Gamma-irradiation (gamma-IR) is extensively used in the treatment of hormone-resistant prostate carcinoma. The objective of the present study was to investigate the effects of 60Co gamma-IR on the growth, cell cycle arrest and cell death of the human prostate cancer cell line DU 145. The viability of DU 145 cells was measured by the Trypan blue exclusion assay and the 3(4,5-dimethylthiazol-2-yl)-2,5,diphenyltetrazolium bromide test. Bromodeoxyuridine incorporation was used for the determination of cell proliferation. Cell cycle arrest and cell death were analyzed by flow cytometry. Superoxide dismutase (SOD), specifically CuZnSOD and MnSOD protein expression, after 10 Gy gamma-IR, was determined by Western immunoblotting analysis. gamma-IR treatment had a significant (P < 0.001) antiproliferative and cytotoxic effect on DU 145 cells. Both effects were time and dose dependent. Also, the dose of gamma-IR which inhibited DNA synthesis and cell proliferation by 50% was 9.7 Gy. Furthermore, gamma-IR induced cell cycle arrest in the G2/M phase and the percentage of cells in the G2/M phase was increased from 15% (control) to 49% (IR cells), with a nonsignificant induction of apoptosis. Treatment with 10 Gy gamma-IR for 24, 48, and 72 h stimulated CuZnSOD and MnSOD protein expression in a time-dependent manner, approximately by 3- to 3.5-fold. These data suggest that CuZnSOD and MnSOD enzymes may play an important role in the gamma-IR-induced changes in DU 145 cell growth, cell cycle arrest and cell death.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Although Helicobacter heilmannii infection is less common than H. pylori infection in humans, it is considered to be of medical importance because of its association with gastritis, gastric ulcer, carcinoma, and mucosa-associated lymphoid tissue lymphoma of the stomach. However, there have been no studies evaluating the role of the Th cell response in H. heilmannii gastric infection. We evaluated the participation of pro-inflammatory and anti-inflammatory cytokines, IFN-gamma and IL-4, in H. heilmannii gastric infection in genetically IFN-gamma- or IL-4-deficient mice. The serum IFN-gamma and IL-4 concentrations were determined by ELISA. The gastric polymorphonuclear infiltrate was higher (P = 0.007) in H. heilmannii-positive than in H. heilmannii-negative wild-type (WT) C57BL/6 mice, whereas no significant inflammation was demonstrable in the stomach of H. heilmannii-positive IFN-gamma-/- C57BL/6 mice. The degree of gastric inflammatory cells, especially in oxyntic mucosa, was also higher (P = 0.007) in infected IL-4-/- than in WT BALB/c mice. Serum IFN-gamma levels were significantly higher in IL-4-/- than in WT BALB/c mice, independently of H. heilmannii-positive or -negative status. Although no difference in serum IFN-gamma levels was seen between H. heilmannii-positive (11.3 ± 3.07 pg/mL, mean ± SD) and -negative (11.07 ± 3.5 pg/mL) WT BALB/c mice, in the group of IL-4-/- animals, the serum concentration of IFN-g was significantly higher in the infected ones (38.16 ± 10.5 pg/mL, P = 0.04). In contrast, serum IL-4 levels were significantly decreased in H. heilmannii-positive (N = 10) WT BALB/c animals compared to the negative (N = 10) animals. In conclusion, H. heilmannii infection induces a predominantly Th1 immune response, with IFN-gamma playing a central role in gastric inflammation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Susceptibility to experimental autoimmune uveitis (EAU) in inbred mice has been associated with a dominant Th1 response. Elevated anti-inter-photoreceptor retinoid-binding protein (anti-IRBP) IgG2a/IgG1 antibody ratios have been implicated as candidate markers to predict disease severity. In the present study, both the anti-IRBP antibody isotype and severity of EAU phenotypes were examined in 4 non-isogenic genetically selected mouse lines to determine if they can be used as general markers of disease. Mice between 8 and 12 weeks old selected for high (H III) or low (L III) antibody response and for maximum (AIR MAX) or minimum (AIR MIN) acute inflammatory reaction (AIR) were immunized with IRBP. Each experiment was performed with at least 5 mice per group. EAU was evaluated by histopathology 21 days after immunization and the minimal criterion was inflammatory cell infiltration of the ciliary body, choroid and retina. Serum IgG1- and IgG2a-specific antibodies were determined by ELISA. EAU was graded by histological examination of the enucleated eyes. The incidence of EAU was lower in AIR MIN mice whereas in the other strains approximately 40% of the animals developed the disease. Low responder animals did not produce anti-IRBP IgG2a antibodies or interferon-gamma. No correlation was observed between susceptibility to EAU and anti-IRBP isotype profiles. Susceptibility to EAU is related to the intrinsic capacity to mount higher inflammatory reactions and increased production of anti-IRBP IgG2a isotype is not necessarily a marker of this immunologic profile.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mycobacterium tuberculosis kills more people than any other single pathogen, with an estimated one-third of the world's population being infected. Among those infected, only 10% will develop the disease. There are several demonstrations that susceptibility to tuberculosis is linked to host genetic factors in twins, family and associated-based case control studies. In the past years, there has been dramatic improvement in our understanding of the role of innate and adaptive immunity in the human host defense to tuberculosis. To date, attention has been paid to the role of genetic host and parasitic factors in tuberculosis pathogenesis mainly regarding innate and adaptive immune responses and their complex interactions. Many studies have focused on the candidate genes for tuberculosis susceptibility ranging from those expressed in several cells from the innate or adaptive immune system such as Toll-like receptors, cytokines (TNF-α, TGF-β, IFN-γ, IL-1b, IL-1RA, IL-12, IL-10), nitric oxide synthase and vitamin D, both nuclear receptors and their carrier, the vitamin D-binding protein (VDBP). The identification of possible genes that can promote resistance or susceptibility to tuberculosis could be the first step to understanding disease pathogenesis and can help to identify new tools for treatment and vaccine development. Thus, in this mini-review, we summarize the current state of investigation on some of the genetic determinants, such as the candidate polymorphisms of vitamin D, VDBP, Toll-like receptor, nitric oxide synthase 2 and interferon-γ genes, to generate resistance or susceptibility to M. tuberculosis infection.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fetal hemoglobin (HbF), encoded by the HBG2 and HBG1 genes, is the best-known genetic modulator of sickle cell anemia, varying dramatically in concentration in the blood of these patients. This variation is partially associated with polymorphisms located in the promoter region of the HBG2 and HBG1 genes. In order to explore known and unknown polymorphisms in these genes, the sequences of their promoter regions were screened in sickle cell anemia patients and correlated with both their HbF levels and their βS-globin haplotypes. Additionally, the sequences were compared with genes from 2 healthy groups, a reference one (N = 104) and an Afro-descendant one (N = 98), to identify polymorphisms linked to the ethnic background.The reference group was composed by healthy individuals from the general population. Four polymorphisms were identified in the promoter region of HBG2 and 8 in the promoter region of HBG1 among the studied groups. Four novel single nucleotide polymorphisms (SNP) located at positions -324, -317, -309 and -307 were identified in the reference group. A deletion located between -396 and -391 in the HBG2 promoter region and the SNP -271 C→T in the HBG1 promoter region were associated with the Central African Republic βS-globin haplotype. In contrast, the -369 C→G and 309 A→G SNPs in the HBG2 promoter region were correlated to the Benin haplotype. The polymorphisms -396_-391 del HBG2, -369 SNP HBG2 and -271 SNP HBG1 correlated with HbF levels. Hence, we suggest an important role of HBG2 and HBG1 gene polymorphisms on the HbF synthesis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The main objective of the present study was to upgrade a clinical gamma camera to obtain high resolution tomographic images of small animal organs. The system is based on a clinical gamma camera to which we have adapted a special-purpose pinhole collimator and a device for positioning and rotating the target based on a computer-controlled step motor. We developed a software tool to reconstruct the target’s three-dimensional distribution of emission from a set of planar projections, based on the maximum likelihood algorithm. We present details on the hardware and software implementation. We imaged phantoms and heart and kidneys of rats. When using pinhole collimators, the spatial resolution and sensitivity of the imaging system depend on parameters such as the detector-to-collimator and detector-to-target distances and pinhole diameter. In this study, we reached an object voxel size of 0.6 mm and spatial resolution better than 2.4 and 1.7 mm full width at half maximum when 1.5- and 1.0-mm diameter pinholes were used, respectively. Appropriate sensitivity to study the target of interest was attained in both cases. Additionally, we show that as few as 12 projections are sufficient to attain good quality reconstructions, a result that implies a significant reduction of acquisition time and opens the possibility for radiotracer dynamic studies. In conclusion, a high resolution single photon emission computed tomography (SPECT) system was developed using a commercial clinical gamma camera, allowing the acquisition of detailed volumetric images of small animal organs. This type of system has important implications for research areas such as Cardiology, Neurology or Oncology.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Our objective was to determine lipid peroxidation and nuclear factor-κB (NF-κB) activation in skeletal muscle and the plasma cytokine profile following maximum progressive swimming. Adult male Swiss mice (N = 15) adapted to the aquatic environment were randomly divided into three groups: immediately after exercise (EX1), 3 h after exercise (EX2) and control. Animals from the exercising groups swam until exhaustion, with an initial workload of 2% of body mass attached to the tail. Control mice did not perform any exercise but were kept immersed in water for 20 min. Maximum swimming led to reactive oxygen species (ROS) generation in skeletal muscle, as indicated by increased thiobarbituric acid reactive species (TBARS) levels (4062.67 ±1487.10 vs 19,072.48 ± 8738.16 nmol malondialdehyde (MDA)/mg protein, control vs EX1). Exercise also promoted NF-κB activation in soleus muscle. Cytokine secretion following exercise was marked by increased plasma interleukin-6 (IL-6) levels 3 h post-exercise (P < 0.05). Interleukin-10 (IL-10) levels were reduced following exercise and remained reduced 3 h post-exercise (P < 0.05). Plasma levels of other cytokines investigated, monocyte chemotactic protein-1 (MCP-1), tumor necrosis factor-alpha (TNF-α), interferon-gamma (IFN-γ) and interleukin-12 (IL-12), were not altered by exercise. The present findings showed that maximum swimming, as well as other exercise models, led to lipid peroxidation and NF-κB activation in skeletal muscle and increased plasma IL-6 levels. The plasma cytokine response was also marked by reduced IL-10 levels. These results were attributed to exercise type and intensity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O processo de envelhecimento ou maturação das bebidas proporciona uma melhora nas características sensoriais da cachaça, tornando-a de qualidade superior e de maior valor econômico. O método tradicional de maturação de bebidas é sua interação com madeiras, sendo que a irradiação pode acelerar este processo de envelhecimento. A cachaça e os tonéis de carvalho de 20 L de capacidade foram submetidos à irradiação gama (150 Gy). Análises físico-químicas e cromatográficas foram realizadas periodicamente ao longo de 390 dias do período de envelhecimento da bebida. A irradiação da cachaça e do tonel não alterou a maioria dos componentes voláteis do coeficiente de congêneres como acidez volátil, ésteres, álcoois superiores e furfural durante os 390 dias. Há evidências, entretanto, de que os parâmetros de alguns componentes como aldeídos, taninos, cor e teor de cobre são de alguma forma influenciados, resultando em aceleração parcial do processo de maturação ou envelhecimento. Ao final do período de envelhecimento, foi feita uma análise sensorial com 30 provadores não treinados. A aceleração do processo de envelhecimento foi confirmada pela avaliação sensorial, e a cachaça e/ou tonel irradiados receberam maior indicação de aprovação em todos os parâmetros analisados (aroma, sabor e aparência).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study was conducted to evaluate the physicochemical and microbiological characteristics of raspberries exposed to different radiation doses. The fruits were harvested in the city of Campestre, MG, packed in polyethylene bags, and transported to the Federal University of Lavras (UFLA), where they were separated into 4 lots. Irradiation was performed at the Center for Development of Nuclear Technology in Belo Horizonte, MG. The doses used were 0 (control), 0.5, 1.0, and 2.0 kGy. After irradiation, the fruits were transported back to UFLA and stored at 1 ºC and 95% relative humidity (RH) for 12 days. The physicochemical analyses for mass loss, total soluble solids, titratable acidity, pH, total soluble sugars, total soluble pectin, firmness, vitamin C content, total antioxidant activity, and total phenolic, and the microbiological assays (coliform at 35 and 45 ºC, psychrotrophic and filamentous fungi and yeasts) were performed after 0, 3, 6, 9, and 12 days of storage. Lower loss of mass and filamentous fungi and yeast count were observed in the irradiated fruits, and 2 kGy was determined as the most effective dose for microbial control, but this irradiation dose also resulted in increased loss of fruit firmness.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Vegetable oils are the richest dietary sources of vitamin E. Vitamin E determination levels in foods are of great importance to adjust the ingestion of nutrients by the population. The purpose of this paper is to determine the concentration of alpha-tocopherol and gamma-tocopherol in vegetable oils and compare the alpha-tocopherol value to the nutritional requirement of vitamin E. The analysis was performed using High Performance Liquid Chromatography. The values expressed as mg/kg for alpha and gamma-tocopherol were, respectively, 120.3±4.2 and 122.0±7.9 in canola oil; 432.3±86.6 and 92.3±9.5 in sunflower oil; 173.0±82.3 and 259.7±43.8 in corn oil; 71.3±6.4 and 273.3±11.1 in soybean oil. A significant difference was encountered between the alpha-tocopherol concentrations in vegetable oils. Similar results were found for gamma-tocopherol, except for corn and soybean oils. It was concluded that the soybean oil was not considered a source of vitamin E. The canola and corn oils were considered sources, and the sunflower oil was considered an excellent source.