231 resultados para (BP)
Resumo:
Single-stranded DNA (ssDNA) is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse) were used at a 100:1 molar ratio in the presence of double-stranded template DNA. The ssDNA thus produced was suitable for immobilisation as probe onto the surface of an Indium tin oxide electrode and hybridisation in a system for sequence-specific electrochemical detection of W. bancrofti. The hybridisation of the ssDNA probe and target ssDNA led to considerable decreases in both the anodic and the cathodic currents of the system's redox couple compared with the unhybridised DNA and could be detected via cyclic voltammetry. This method is reproducible and avoids many of the difficulties encountered by conventional methods of filarial parasite DNA detection; thus, it has potential in xenomonitoring.
Resumo:
A single polymerase chain reaction (PCR) reaction targeting the spliced-leader intergenic region of Trypanosoma cruzi I was standardised by amplifying a 231 bp fragment in domestic (TcIDOM) strains or clones and 450 and 550 bp fragments in sylvatic strains or clones. This reaction was validated using 44 blind coded samples and 184 non-coded T. cruzi I clones isolated from sylvatic triatomines and the correspondence between the amplified fragments and their domestic or sylvatic origin was determined. Six of the nine strains isolated from acute cases suspected of oral infection had the sylvatic T. cruzi I profile. These results confirmed that the sylvatic T. cruzi I genotype is linked to cases of oral Chagas disease in Colombia. We therefore propose the use of this novel PCR reaction in strains or clones previously characterised as T. cruziI to distinguish TcIDOMfrom sylvatic genotypes in studies of transmission dynamics, including the verification of population selection within hosts or detection of the frequency of mixed infections by both T. cruzi I genotypes in Colombia.
Resumo:
Mosquitoes are the culprits of some of the most important vector borne diseases. A species’ potential as a vector is directly dependent on their pattern of behaviour, which is known to change according to the female’s physiological status such as whether the female is virgin/mated and unfed/blood-fed. However, the molecular mechanism triggered by and/or responsible for such modulations in behaviour is poorly understood. Clock genes are known to be responsible for the control of circadian behaviour in several species. Here we investigate the impact mating and blood-feeding have upon the expression of these genes in the mosquito Aedes aegypti . We show that blood intake, but not insemination, is responsible for the down-regulation of clock genes. Using RNA interference, we observe a slight reduction in the evening activity peak in the fourth day after dstim injection. These data suggest that, as in Drosophila , clock gene expression, circadian behaviour and environmental light regimens are interconnected in Ae. aegypti .
Resumo:
Two snapshot surveys to establish the diversity and ecological preferences of mosquitoes (Diptera: Culicidae) in the terra firme primary rain forest surrounding the Tiputini Biodiversity Station in the UNESCO Yasuní Biosphere Reserve of eastern Amazonian Ecuador were carried out in November 1998 and May 1999. The mosquito fauna of this region is poorly known; the focus of this study was to obtain high quality link-reared specimens that could be used to unequivocally confirm species level diversity through integrated systematic study of all life stages and DNA sequences. A total of 2,284 specimens were preserved; 1,671 specimens were link-reared with associated immature exuviae, all but 108 of which are slide mounted. This study identified 68 unique taxa belonging to 17 genera and 27 subgenera. Of these, 12 are new to science and 37 comprise new country records. DNA barcodes [658-bp of the mtDNA cytochrome c oxidase ( COI ) I gene] are presented for 58 individuals representing 20 species and nine genera. DNA barcoding proved useful in uncovering and confirming new species and we advocate an integrated systematics approach to biodiversity studies in future. Associated bionomics of all species collected are discussed. An updated systematic checklist of the mosquitoes of Ecuador (n = 179) is presented for the first time in 60 years.
Resumo:
An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.
Resumo:
The aim of the present study was to detect natural infection by Leishmania (Leishmania) infantum in Lutzomyia longipalpis captured in Barcarena, state of Pará, Brazil, through the use of three primer sets. With this approach, it is unnecessary to previously dissect the sandfly specimens. DNA of 280 Lu. longipalpis female specimens were extracted from the whole insects. PCR primers for kinetoplast minicircle DNA (kDNA), the mini-exon gene and the small subunit ribosomal RNA (SSU-rRNA) gene of Leishmania were used, generating fragments of 400 bp, 780 bp and 603 bp, respectively. Infection by the parasite was found with the kDNA primer in 8.6% of the cases, with the mini-exon gene primer in 7.1% of the cases and with the SSU-rRNA gene primer in 5.3% of the cases. These data show the importance of polymerase chain reaction as a tool for investigating the molecular epidemiology of visceral leishmaniasis by estimating the risk of disease transmission in endemic areas, with the kDNA primer representing the most reliable marker for the parasite.
Resumo:
In the Americas, areas with a high risk of malaria transmission are mainly located in the Amazon Forest, which extends across nine countries. One keystone step to understanding the Plasmodium life cycle in Anopheles species from the Amazon Region is to obtain experimentally infected mosquito vectors. Several attempts to colonise Ano- pheles species have been conducted, but with only short-lived success or no success at all. In this review, we review the literature on malaria transmission from the perspective of its Amazon vectors. Currently, it is possible to develop experimental Plasmodium vivax infection of the colonised and field-captured vectors in laboratories located close to Amazonian endemic areas. We are also reviewing studies related to the immune response to P. vivax infection of Anopheles aquasalis, a coastal mosquito species. Finally, we discuss the importance of the modulation of Plasmodium infection by the vector microbiota and also consider the anopheline genomes. The establishment of experimental mosquito infections with Plasmodium falciparum, Plasmodium yoelii and Plasmodium berghei parasites that could provide interesting models for studying malaria in the Amazonian scenario is important. Understanding the molecular mechanisms involved in the development of the parasites in New World vectors is crucial in order to better determine the interaction process and vectorial competence.
Resumo:
Bacillus thuringiensisis a ubiquitous Gram-positive and sporulating bacterium. Its crystals and secreted toxins are useful tools against larvae of diverse insect orders and, as a consequence, an alternative to recalcitrant chemical insecticides. We report here the draft genome sequence ofB. thuringiensis147, a strain isolated from Brazil and with high insecticidal activity. The assembled genome contained 6,167,994 bp and was distributed in seven replicons (a chromosome and 6 plasmids). We identified 12 coding regions, located in two plasmids, which encode insecticidal proteins.
Resumo:
Leishmania donovani is the known causative agent of both cutaneous (CL) and visceral leishmaniasis in Sri Lanka. CL is considered to be under-reported partly due to relatively poor sensitivity and specificity of microscopic diagnosis. We compared robustness of three previously described polymerase chain reaction (PCR) based methods to detectLeishmania DNA in 38 punch biopsy samples from patients presented with suspected lesions in 2010. Both, Leishmaniagenus-specific JW11/JW12 KDNA and LITSR/L5.8S internal transcribed spacer (ITS)1 PCR assays detected 92% (35/38) of the samples whereas a KDNA assay specific forL. donovani (LdF/LdR) detected only 71% (27/38) of samples. All positive samples showed a L. donovani banding pattern upon HaeIII ITS1 PCR-restriction fragment length polymorphism analysis. PCR assay specificity was evaluated in samples containing Mycobacterium tuberculosis, Mycobacterium leprae, and human DNA, and there was no cross-amplification in JW11/JW12 and LITSR/L5.8S PCR assays. The LdF/LdR PCR assay did not amplify M. leprae or human DNA although 500 bp and 700 bp bands were observed in M. tuberculosis samples. In conclusion, it was successfully shown in this study that it is possible to diagnose Sri Lankan CL with high accuracy, to genus and species identification, using Leishmania DNA PCR assays.
Resumo:
Klebsiella pneumoniae U25 is a multidrug resistant strain isolated from a tertiary care hospital in Chennai, India. Here, we report the complete annotated genome sequence of strain U25 obtained using PacBio RSII. This is the first report of the whole genome of K. pneumoniaespecies from Chennai. It consists of a single circular chromosome of size 5,491,870-bp and two plasmids of size 211,813 and 172,619-bp. The genes associated with multidrug resistance were identified. The chromosome of U25 was found to have eight antibiotic resistant genes [blaOXA-1,blaSHV-28, aac(6’)1b-cr,catB3, oqxAB, dfrA1]. The plasmid pMGRU25-001 was found to have only one resistant gene (catA1) while plasmid pMGRU25-002 had 20 resistant genes [strAB, aadA1,aac(6’)-Ib, aac(3)-IId,sul1,2, blaTEM-1A,1B,blaOXA-9, blaCTX-M-15,blaSHV-11, cmlA1, erm(B),mph(A)]. A mutation in the porin OmpK36 was identified which is likely to be associated with the intermediate resistance to carbapenems in the absence of carbapenemase genes. U25 is one of the few K. pneumoniaestrains to harbour clustered regularly interspaced short palindromic repeats (CRISPR) systems. Two CRISPR arrays corresponding to Cas3 family helicase were identified in the genome. When compared to K. pneumoniaeNTUHK2044, a transposase gene InsH of IS5-13 was found inserted.
Resumo:
The complete genome sequence of bovine papillomavirus 2 (BPV2) from Brazilian Amazon Region was determined using multiple-primed rolling circle amplification followed by Illumina sequencing. The genome is 7,947 bp long, with 45.9% GC content. It encodes seven early (E1, E2,E4, E5, E6,E7, and E8) and two late (L1 and L2) genes. The complete genome of a BPV2 can help in future studies since this BPV type is highly reported worldwide although the lack of complete genome sequences available.
Resumo:
Acinetobacter baumannii, a strictly aerobic, non-fermentative, Gram-negative coccobacillary rod-shaped bacterium, is an opportunistic pathogen in humans. We recently isolated a multidrug-resistant A. baumannii strain KBN10P02143 from the pus sample drawn from a surgical patient in South Korea. We report the complete genome of this strain, which consists of 4,139,396 bp (G + C content, 39.08%) with 3,868 protein-coding genes, 73 tRNAs and six rRNA operons. Identification of the genes related to multidrug resistance from this genome and the discovery of a novel conjugative plasmid will increase our understanding of the pathogenicity associated with this species.
Resumo:
Genetic variability of a population of Aedes aegypti from Paraná, Brazil, using the mitochondrial ND4 gene. To analyze the genetic variability of populations of Aedes aegypti, 156 samples were collected from 10 municipalities in the state of Paraná, Brazil. A 311 base pairs (bp) region of the NADH dehydrogenase subunit 4 (ND4) mitochondrial gene was examined. An analysis of this fragment identified eight distinct haplotypes. The mean genetic diversity was high (h = 0.702; p = 0.01556). AMOVA analysis indicated that most of the variation (67%) occurred within populations and the F ST value (0.32996) was highly significant. F ST values were significant in most comparisons among cities. The isolation by distance was not significant (r = -0.1216 and p = 0, 7550), indicating that genetic distance is not related to geographic distance. Neighbor-joining analysis showed two genetically distinct groups within Paraná. The DNA polymorphism and AMOVA data indicate a decreased gene flow in populations from Paraná, which can result in increased vectorial competence.
Resumo:
The evolution of organic matter sources in soil is related to climate and vegetation dynamics in the past recorded in paleoenvironmental Quaternary deposits such as peatlands. For this reason, a Histosol of the mineralotrophic peatland from the Pau-de-Fruta Special Protection Area - SPA, Espinhaço Meridional, State of Minas Gerais, was described and characterized to evidence the soil constituent materials and properties as related to changes in environmental conditions, supported by the isotopic and elementary characterization of soil C and N and 14C ages. Samples were collected in a depression at 1,350 m asl, where Histosols are possibly more developed due to the great thickness (505 cm). Nowadays, the area is colonized by vegetation physiognomies of the Cerrado Biome, mainly rocky and wet fields (Campo Rupestre and Campo Úmido), aside from fragments of Semidecidual Seasonal Forest, called Capões forests. The results this study showed that early the genesis of the analyzed soil profile showed a high initial contribution of mostly herbaceous organic matter before 8,090 ± 30 years BP (14C age). In the lower-mid Holocene, between 8,090 ± 30 years AP (14C age) to ± 4,100 years BP (interpolated age), the vegetation gradually became more woody, with forest expansion, possibly due to increased humidity, suggesting the existence of a more woody Cerrado in the past than at present. Drier climate conditions than the current were concluded ± 2,500 years BP (interpolated age) and that after 430 years BP (14C age) the forest gave way to grassland, predominantly. After the dry season, humidity increased to the current conditions. Due to these climate fluctuations during the Holocene, three decomposition stages of organic matter were observed in the Histosols of this study, with prevalence of the most advanced (sapric), typical of a deposit in a highly advanced stage of pedogenetic evolution.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.