Hypothyroidism decreases proinsulin gene expression and the attachment of its mRNA and eEF1A protein to the actin cytoskeleton of INS-1E cells

The actions of thyroid hormone (TH) on pancreatic beta cells have not been thoroughly explored, with current knowledge being limited to the modulation of insulin secretion in response to glucose, and beta cell viability by regulation of pro-mitotic and pro-apoptotic factors. Therefore, the effects of TH on proinsulin gene expression are not known. This led us to measure: a) proinsulin mRNA expression, b) proinsulin transcripts and eEF1A protein binding to the actin cytoskeleton, c) actin cytoskeleton arrangement, and d) proinsulin mRNA poly(A) tail length modulation in INS-1E cells cultured in different media containing: i) normal fetal bovine serum - FBS (control); ii) normal FBS plus 1 µM or 10 nM T3, for 12 h, and iii) FBS depleted of TH for 24 h (Tx). A decrease in proinsulin mRNA content and attachment to the cytoskeleton were observed in hypothyroid (Tx) beta cells. The amount of eEF1A protein anchored to the cytoskeleton was also reduced in hypothyroidism, and it is worth mentioning that eEF1A is essential to attach transcripts to the cytoskeleton, which might modulate their stability and rate of translation. Proinsulin poly(A) tail length and cytoskeleton arrangement remained unchanged in hypothyroidism. T3 treatment of control cells for 12 h did not induce any changes in the parameters studied. The data indicate that TH is important for proinsulin mRNA expression and translation, since its total amount and attachment to the cytoskeleton are decreased in hypothyroid beta cells, providing evidence that effects of TH on carbohydrate metabolism also include the control of proinsulin gene expression.

Leptin receptor (Ob-R) mRNA expression and serum leptin concentration in patients with colorectal and metastatic colorectal cancer

The objective of the present study was to investigate the effect of leptin on the progression of colorectal carcinoma to metastatic disease by analyzing the serum leptin concentration and Ob-R gene expression in colon cancer tissues. Tissue samples were obtained from 31 patients who underwent surgical resection for colon (18 cases) and metastatic colon (13 cases) cancer. Serum leptin concentration was determined by an enzyme-linked immunosorbent assay (ELISA) and Ob-R mRNA expression by real-time polymerase chain reaction (RT-PCR) for both groups. ELISA data were analyzed by the Student t-test and RT-PCR data were analyzed by the Mann-Whitney U-test. RT-PCR results demonstrated that mRNA expression of Ob-R in human metastatic colorectal cancer was higher than in local colorectal cancer tissues. On the other hand, mean serum leptin concentration was significantly higher in local colorectal cancer patients compared to patients with metastatic colorectal cancer. The results of the present study suggest a role for leptin in the progression of colon cancer to metastatic disease without weight loss. In other words, significantly increased Ob-R mRNA expression and decreased serum leptin concentration in patients with metastatic colon cancer indicate that sensitization to leptin activity may be a major indicator of metastasis to the colon tissue and the determination of leptin concentration and leptin gene expression may be used to aid the diagnosis.

Differential effects of aging on spatial contrast sensitivity to linear and polar sine-wave gratings

Changes in visual function beyond high-contrast acuity are known to take place during normal aging. We determined whether sensitivity to linear sine-wave gratings and to an elementary stimulus preferentially processed in extrastriate areas could be distinctively affected by aging. We measured spatial contrast sensitivity twice for concentric polar (Bessel) and vertical linear gratings of 0.6, 2.5, 5, and 20 cycles per degree (cpd) in two age groups (20-30 and 60-70 years). All participants were free of identifiable ocular disease and had normal or corrected-to-normal visual acuity. Participants were more sensitive to Cartesian than to polar gratings in all frequencies tested, and the younger adult group was more sensitive to all stimuli tested. Significant differences between sensitivities of the two groups were found for linear (only 20 cpd; P<0.01) and polar gratings (all frequencies tested; P<0.01). The young adult group was significantly more sensitive to linear than to circular gratings in the 20 cpd frequency. The older adult group was significantly more sensitive to linear than to circular gratings in all spatial frequencies, except in the 20 cpd frequency. The results suggest that sensitivity to the two kinds of stimuli is affected differently by aging. We suggest that neural changes in the aging brain are important determinants of this difference and discuss the results according to current models of human aging.

Downregulation of TIM-3 mRNA expression in peripheral blood mononuclear cells from patients with systemic lupus erythematosus

The T-cell immunoglobulin and mucin domain (TIM) family is associated with autoimmune diseases, but its expression level in the immune cells of systemic lupus erythematosus (SLE) patients is not known. The aim of this study was to investigate whether the expression of TIM-3 mRNA is associated with pathogenesis of SLE. Quantitative real-time reverse transcription-polymerase chain reaction analysis (qRT-PCR) was used to determine TIM-1, TIM-3, and TIM-4 mRNA expression in peripheral blood mononuclear cells (PBMCs) from 132 patients with SLE and 62 healthy controls. The PBMC surface protein expression of TIMs in PBMCs from 20 SLE patients and 15 healthy controls was assayed by flow cytometry. Only TIM-3 mRNA expression decreased significantly in SLE patients compared with healthy controls (P<0.001). No significant differences in TIM family protein expression were observed in leukocytes from SLE patients and healthy controls (P>0.05). SLE patients with lupus nephritis (LN) had a significantly lower expression of TIM-3 mRNA than those without LN (P=0.001). There was no significant difference in the expression of TIM-3 mRNA within different classes of LN (P>0.05). Correlation of TIM-3 mRNA expression with serum IgA was highly significant (r=0.425, P=0.004), but was weakly correlated with total serum protein (rs=0.283, P=0.049) and serum albumin (rs=0.297, P=0.047). TIM-3 mRNA expression was weakly correlated with the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI; rs=-0.272, P=0.032). Our results suggest that below-normal expression of TIM-3 mRNA in PBMC may be involved in the pathogenesis of SLE.

B cells expressing IL-10 mRNA modulate memory T cells after DNA-Hsp65 immunization

In DNA vaccines, the gene of interest is cloned into a bacterial plasmid that is engineered to induce protein production for long periods in eukaryotic cells. Previous research has shown that the intramuscular immunization of BALB/c mice with a naked plasmid DNA fragment encoding the Mycobacterium leprae 65-kDa heat-shock protein (pcDNA3-Hsp65) induces protection against M. tuberculosis challenge. A key stage in the protective immune response after immunization is the generation of memory T cells. Previously, we have shown that B cells capture plasmid DNA-Hsp65 and thereby modulate the formation of CD8+ memory T cells after M. tuberculosis challenge in mice. Therefore, clarifying how B cells act as part of the protective immune response after DNA immunization is important for the development of more-effective vaccines. The aim of this study was to investigate the mechanisms by which B cells modulate memory T cells after DNA-Hsp65 immunization. C57BL/6 and BKO mice were injected three times, at 15-day intervals, with 100 µg naked pcDNA-Hsp65 per mouse. Thirty days after immunization, the percentages of effector memory T (TEM) cells (CD4+ and CD8+/CD44high/CD62Llow) and memory CD8+ T cells (CD8+/CD44high/CD62Llow/CD127+) were measured with flow cytometry. Interferon γ, interleukin 12 (IL-12), and IL-10 mRNAs were also quantified in whole spleen cells and purified B cells (CD43−) with real-time qPCR. Our data suggest that a B-cell subpopulation expressing IL-10 downregulated proinflammatory cytokine expression in the spleen, increasing the survival of CD4+ TEM cells and CD8+ TEM/CD127+ cells.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Evaluating the wage differential between public and private sectors in Brazil

This paper uses a rotating panel of households to analyze wage differentials between public and private sectors in Brazil. Focusing on the transition of individuals between jobs available in the public and private sectors and controlling for individual time invariant characteristics, we find evidence of small wage differentials in favor of the public sector.