Skin morphology of the mutant hairless USP mouse

The morphology of the skin of the mutant hairless USP mouse was studied by histological, histochemical and immunohistochemical methods and compared to the skin of BALB/c mice. Representative sections of the dorsal skin from mice of both strains aged 18 days, and 1, 3, 6, and 8 months were studied. Sections stained with hematoxylin and eosin showed cystic formations called utricles and dermal cysts in the dermis that increased in size and number during growth. Skin thickness increased significantly at 8 months. Sections stained with picrosirius and examined with polarized light, displayed different colors, suggesting different thicknesses of dermal collagen fibers (probably types I and III). Weigert, Verhoeff and resorcin-fuchsin stains revealed fibers of the elastic system. The PAS and Alcian blue methods revealed neutral and acid glycosaminoglycans in the skin ground substance of both mouse strains. Immunohistochemical staining for fibronectin and laminin did not show differences between the mutant and BALB/c mice. Mast cells stained by the Gomori method and macrophages positive for HAM 56 antibodies were observed in both mouse strains. Except for the presence of enlarged cysts in the hairless strain, no qualitative differences were found during development of the skin of BALB/c and the mutant hairless mice.

An extract of Polygonum multiflorum protects against free radical damage induced by ultraviolet B irradiation of the skin

Over the last decades, the incidence of ultraviolet B (UVB)-related skin problems has been increasing. Damages induced by UVB radiation are related to mutations that occur as a result of direct DNA damage and/or the production of reactive oxygen species. We investigated the anti-oxidant effects of a Polygonum multiflorum thumb extract against skin damage induced by UVB irradiation. Female SKH-1 hairless mice were divided into three groups: control (N = 7), distilled water- (N = 10), and P. multiflorum extract-treated (PM, N = 10) groups. The PM (10 g) was extracted with 100 mL distilled water, cryo-dried and 9.8 g was obtained. The animals received a topical application of 500 µL distilled water or PM extract (1, 2, 4, 8, and 16%, w/v, dissolved in distilled water) for 30 min after UVB irradiation (wavelength 280-320 nm, 300 mJ/cm²; 3 min) of the dorsal kin for 14 days, and skin immunohistochemistry and Cu,Zn-superoxide dismutase (SOD1) activity were determined. SOD1 immunoreactivity, its protein levels and activities in the skin were significantly reduced by 70% in the distilled water-treated group after UVB irradiation compared to control. However, in the PM extract-treated groups, SOD1 immunoreactivity and its protein and activity levels increased in a dose-dependent manner (1-16%, w/v, PM extract) compared to the distilled water-treated group. SOD1 protein levels and activities in the groups treated with 8 and 16%, w/v, PM extract recovered to 80-90% of the control group levels after UVB. These results suggest that PM extract strongly inhibits the destruction of SOD1 by UV radiation and probably contains anti-skin photoaging agents.

The selective and non-selective cyclooxygenase inhibitors valdecoxib and piroxicam induce the same postoperative analgesia and control of trismus and swelling after lower third molar removal

We compared the clinical efficacy of orally administered valdecoxib and piroxicam for the prevention of pain, trismus and swelling after removal of horizontally and totally intrabony impacted lower third molars. Twenty-five patients were scheduled to undergo removal of symmetrically positioned lower third molars in two separate appointments. Valdecoxib (40 mg) or piroxicam (20 mg) was administered in a double-blind, randomized and crossed manner for 4 days after the surgical procedures. Objective and subjective parameters were recorded for comparison of postoperative courses. Both agents were effective for postoperative pain relief (N = 19). There was a similar mouth opening at suture removal compared with the preoperative values (86.14 ± 4.36 and 93.12 ± 3.70% of the initial measure for valdecoxib and piroxicam, respectively; ANOVA). There was no significant difference regarding the total amount of rescue medication taken by the patients treated with valdecoxib or piroxicam (173.08 ± 91.21 and 461.54 ± 199.85 mg, respectively; Wilcoxon test). There were no significant differences concerning the swelling observed on the second postoperative day compared to baseline measures (6.15 ± 1.84 and 8.46 ± 2.04 mm for valdecoxib and piroxicam, respectively; ANOVA) or on the seventh postoperative day (1.69 ± 1.61 and 2.23 ± 2.09 mm for valdecoxib and piroxicam, respectively; ANOVA). The cyclooxygenase-2 selective inhibitor valdecoxib is as effective as the non-selective cyclooxygenase inhibitor piroxicam for pain, trismus and swelling control after removal of horizontally and totally intrabony impacted lower third molars.

Modifications of the sympathetic skin response in workers chronically exposed to lead

The long-term effects of low-level lead intoxication are not known. The sympathetic skin response (SSR) was evaluated in a group of 60 former workers of a primary lead smelter, located in Santo Amaro, BA, Brazil. The individuals participating in the study were submitted to a clinical-epidemiological evaluation including questions related to potential risk factors for intoxication, complaints related to peripheral nervous system (PNS) involvement, neurological clinical examination, and also to electromyography and nerve conduction studies and SSR evaluation. The sample consisted of 57 men and 3 women aged 34 to 69 years (mean ± SD: 46.8 ± 6.9). The neurophysiologic evaluation showed the presence of lumbosacral radiculopathy in one of the individuals (1.7%), axonal sensorimotor polyneuropathy in 2 (3.3%), and carpal tunnel syndrome in 6 (10%). SSR was abnormal or absent in 12 cases, representing 20% of the sample. More than half of the subjects (53.3%) reported a history of acute abdominal pain requiring hospitalization during the period of work at the plant. A history of acute palsy of radial and peroneal nerves was reported by about 16.7 and 8.3% of the individuals, respectively. Mean SSR amplitude did not differ significantly between patients presenting or not the various characteristics in the current neurological situation, except for diaphoresis. The results suggest that chronic lead intoxication induces PNS damage, particularly affecting unmyelinated small fibers. Further systematic study is needed to more precisely define the role of lead in inducing PNS injury.

Proton magnetic resonance spectroscopy of the frontal, cingulate and perirolandic cortices and its relationship to skin conductance in patients with schizophrenia

The aim of the present study was to determine whether specific subgroups of schizophrenic patients, grouped according to electrodermal characteristics, show differences in the N-acetylaspartate/creatine plus choline (NAA / (Cr + Cho)) ratios in the frontal, cingulate and perirolandic cortices. Skin conductance levels (SCL) and skin conductance responses to auditory stimulation were measured in 38 patients with schizophrenia and in the same number of matched healthy volunteers (control). All subjects were submitted to multivoxel proton magnetic resonance spectroscopic imaging. When compared to the control group, patients presented significantly lower NAA / (Cr + Cho) ratios in the right dorsolateral prefrontal cortex (schizophrenia = 0.95 ± 0.03; control = 1.12 ± 0.04) and in the right (schizophrenia = 0.88 ± 0.02; control = 0.94 ± 0.03) and left (schizophrenia = 0.84 ± 0.03; control = 0.94 ± 0.03) cingulates. These ratios did not differ between electrodermally responsive and non-responsive patients. When patients were divided into two groups: lower SCL (less than the mean SCL of the control group minus two standard deviations) and normal SCL (similar to the control group), the subgroup with a lower level of SCL showed a lower NAA / (Cr + Cho) ratio in the left cingulate (0.78 ± 0.05) than the controls (0.95 ± 0.02, P < 0.05) and the subgroup with normal SCL (0.88 ± 0.03, P < 0.05). There was a negative correlation between the NAA / (Cr + Cho) ratio in the left cingulate of patients with schizophrenia and the duration of the disease and years under medication. These data suggest the existence of a schizophrenic subgroup characterized by low SCL that could be a consequence of the lower neuronal viability observed in the left cingulate of these patients.

Anti-Leishmania titers and positive skin tests in patients cured of kala-azar

Visceral leishmaniasis (VL), also known as kala-azar, is an important public health problem. If not treated, virtually all clinically symptomatic patients die within months. The diagnosis is based on the Montenegro skin test (MST) and anti-Leishmania titers. Nevertheless, the time required for cured individuals living in a leishmaniasis-endemic area to present a positive skin test and negative anti-Leishmania serology is known. To determine the cellular and humoral immune response profile in relation to different times post-VL cure, a cross-sectional study was conducted on subjects from a kala-azar endemic area in Paço do Lumiar, MA, Brazil, on the basis of 1995-2005 notifications reported by the National Health Foundation/Regional Coordination of Maranhão. We visited cured individuals with a history of VL within the last 10 years. Seventy-four subjects (30 females) ranging in age from 1 to 44 years were included, all of them symptom free at the time of the study. A cellular immune response was observed in 73 (98.6%) subjects, whereas no significant antibody titers were detected by indirect immunofluorescence (IIF) in the sera of 69 (93.2%) cases. Ten years post-cure, 39 (52%) subjects had a positive MST and negative IIF reaction, while in one subject the skin and anti-Leishmania serology tests were negative. Two other subjects were positive in both tests 1 year after cure. These data suggest that a cellular immune response may still be present in subjects cured of VL regardless of post-cure time, and that the parasite persists in the host after clinical cure of the disease. This would explain the persistence of significant Leishmania sp antibody titers in some subjects after treatment.

Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Prolonged acceptance of skin grafts induced by B cells places regulatory T cells on the histopathology scene

The participation of regulatory T (Treg) cells in B cell-induced T cell tolerance has been claimed in different models. In skin grafts, naive B cells were shown to induce graft tolerance. However, neither the contribution of Treg cells to B cell-induced skin tolerance nor their contribution to the histopathological diagnosis of graft acceptance has been addressed. Here, using male C57BL/6 naive B cells to tolerize female animals, we show that skin graft tolerance is dependent on CD25+ Treg cell activity and independent of B cell-derived IL-10. In fact, B cells from IL-10-deficient mice were able to induce skin graft tolerance while Treg depletion of the host inhibited 100% graft survival. We questioned how Treg cell-mediated tolerance would impact on histopathology. B cell-tolerized skin grafts showed pathological scores as high as a rejected skin from naive, non-tolerized mice due to loss of skin appendages, reduced keratinization and mononuclear cell infiltrate. However, in tolerized mice, 40% of graft infiltrating CD4+ cells were FoxP3+ Treg cells with a high Treg:Teff (effector T cell) ratio (6:1) as compared to non-tolerized mice where Tregs comprise less than 8% of total infiltrating CD4 cells with a Treg:Teff ratio below 1:1. These results render Treg cells an obligatory target for histopathological studies on tissue rejection that may help to diagnose and predict the outcome of a transplanted organ.

Relationship of macrophage migration inhibitory factor levels in PBMCs, lesional skin and serum with disease severity and activity in vitiligo vulgaris

Melanocyte loss in vitiligo vulgaris is believed to be an autoimmune process. Macrophage migration inhibitory factor (MIF) is involved in many autoimmune skin diseases. We determined the possible role of MIF in the pathogenesis of vitiligo vulgaris, and describe the relationship between MIF expressions and disease severity and activity. Serum MIF concentrations and mRNA levels in PBMCs were measured in 44 vitiligo vulgaris patients and 32 normal controls, using ELISA and real-time RT-PCR. Skin biopsies from 15 patients and 6 controls were analyzed by real-time RT-PCR. Values are reported as median (25th-75th percentile). Serum MIF concentrations were significantly increased in patients [35.81 (10.98-43.66) ng/mL] compared to controls [7.69 (6.01-9.03) ng/mL]. MIF mRNA levels were significantly higher in PBMCs from patients [7.17 (3.59-8.87)] than controls [1.67 (1.23-2.42)]. There was also a significant difference in MIF mRNA levels in PBMCs between progressive and stable patients [7.86 (5.85-9.13)vs 4.33 (2.23-8.39)] and in serum MIF concentrations [40.47 (27.71-46.79) vs 26.80 (10.55-36.07) ng/mL]. In addition, the vitiligo area severity index scores of patients correlated positively with changes of both serum MIF concentrations (r = 0.488) and MIF mRNA levels in PBMCs (r = 0.426). MIF mRNA levels were significantly higher in lesional than in normal skin [2.43 (2.13-7.59)vs 1.18 (0.94-1.83)] and in patients in the progressive stage than in the stable stage [7.52 (2.43-8.84)vs 2.13 (1.98-2.64)]. These correlations suggest that MIF participates in the pathogenesis of vitiligo vulgaris and may be useful as an index of disease severity and activity.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

High prevalence of methicillin resistance and PVL genes amongStaphylococcus aureus isolates from the nares and skin lesions of pediatric patients with atopic dermatitis

Staphylococcus aureus is highly prevalent among patients with atopic dermatitis (AD), and this pathogen may trigger and aggravate AD lesions. The aim of this study was to determine the prevalence of S. aureus in the nares of pediatric subjects and verify the phenotypic and molecular characteristics of the isolates in pediatric patients with AD. Isolates were tested for antimicrobial susceptibility, SCCmectyping, and Panton-Valentine Leukocidin (PVL) genes. Lineages were determined by pulsed-field gel electrophoresis and multilocus sequence typing (MLST). AD severity was assessed with the Scoring Atopic Dermatitis (SCORAD) index. Among 106 patients, 90 (85%) presented S. aureus isolates in their nares, and 8 also presented the pathogen in their skin infections. Two patients had two positive lesions, making a total of 10 S. aureusisolates from skin infections. Methicillin-resistant S. aureus(MRSA) was detected in 24 (26.6%) patients, and PVL genes were identified in 21 (23.3%), including 6 (75%) of the 8 patients with skin lesions but mainly in patients with severe and moderate SCORAD values (P=0.0095). All 24 MRSA isolates were susceptible to trimethoprim/sulfamethoxazole, while 8 isolates had a minimum inhibitory concentration (MIC) to mupirocin >1024 μg/mL. High lineage diversity was found among the isolates including USA1100/ST30, USA400/ST1, USA800/ST5, ST83, ST188, ST718, ST1635, and ST2791. There was a high prevalence of MRSA and PVL genes among the isolates recovered in this study. PVL genes were found mostly among patients with severe and moderate SCORAD values. These findings can help clinicians improve the therapies and strategies for the management of pediatric patients with AD.

Modifications in the chemical compounds and sensorial attributes of Engraulis anchoita fillet during marinating process

Marinated fish are fish products preserved by the combined action of salt and organic acids. The objective of this work was to analyze the variations in the chemical compounds of anchovy fillets that give them sensorial characteristics during the marinating process of Engraulis anchoita. The protein content decreased slightly and the TVB-N level decreased significantly in both the brining and marinating stages. In the marinating stage an increase in the total free aminoacids was observed. The NBV level in the brining and marinating solutions increased during these stages due to the solubilization of the non-protein nitrogenous compounds and the degradation of some protein compounds.The decrease of the contents of protein and TVB-N, and the increase of the acidity and the free aminoacids content during the marinating process give the marinated fillets the characteristic texture and aroma.

Effect of controlled atmosphere on postharvest quality of 'Douradão' peaches

This study was carried out with one of the most important cultivar grown in the State of Sao Paulo, Brazil, which has gained the preference of consumers, due to its sweet taste, intense skin color and large size; however, these fruits are susceptible to chilling injury when cold stored for long periods. The use of controlled atmosphere (CA) with elevated CO2 and reduced O2 concentrations prevent the onset of the chilling symptom. Thus, the effect of three different conditions of controlled atmosphere (CA1, CA2, CA3 and Control) was evaluated in order to extend the storage life of 'Douradão' peaches. After 14, 21 and 28 days, samples were withdrawn from CA and kept in fresh air at 25 ± 1 °C and 90 ± 5% RH to complete ripening. On the day of removal and after 4 days, were the peaches quality characteristics were evaluated. The results showed that the use of CA during cold storage reduced weight loss and prevented postharvest decay. CA2 and CA3 treatments were effective in keeping good quality of 'Douradão' peaches during 28 days of cold storage, the ripe fruits showed reduced incidence of woolliness, adequate juiciness and flesh firmness. CA1 and Control treatments did not present marketable conditions after 14 days of cold storage.

Microbiological and physicochemical characterization of surimi obtained from waste of piramutaba fillet

The aim of this work was to perform the microbiological and physicochemical characterization of surimi made from waste of piramutaba filleting. The results of physicochemical characterization of the waste and surimi were: moisture (76.37 and 79.11%), total lipids (5.35 and 0.74%), proteins (14.92 and 10.79%), ash (3.03 and 2.35%), pH (6.9 and 7.4), caloric value (109.15 and 77.86 kcal.g-1), and water activity (both 0.98), respectively. The results of the levels of total volatile bases were 7.29 mgN/100-1 g (waste) and 7.01% carbohydrate (surimi). The values of total lipids and proteins were reduced during the preparation of surimi, probably due to successive washes during the processing. Waste and surimi were examined microbiologically and are in compliance with required parameters. The results show a loss of red (a* parameter) and yellow (b* parameter) color. On the other hand, the L* parameter (lightness) increased after the processing of surimi. It can be concluded that piramutaba waste can be used for surimi preparation and as a source of nutrients for human consumption, providing an alternative use of these wastes avoiding their disposal polluting the environment.

Physical and chemical properties of wami tilapia skin gelatin

Gelatin was extracted from the skin of tilapia (Oreochromis urolepis hornorum) and characterized according to its physical and chemical properties. It had pH 4.66, which is slightly higher than the values reported for gelatins processed by acid solubilization. In general, the ionic content was low, and the average yield of the process was 5.10 g/100 g. The proximal composition of the gelatin was similar to that of the commercial gelatins, with slightly higher moisture content. The tilapia skin gelatin had whitish-yellow color and average turbidity of 67 NTU.