Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts from tissue biopsies of patients who underwent plastic surgery for repairing hypertrophic scars. The fibroblasts were then treated with different concentrations of bFGF (ranging from 0.1 to 1000 ng/mL). The growth of hypertrophic scar fibroblasts became slower with selective inhibition of type I collagen production after exposure to bFGF. However, type III collagen expression was affected in both normal and hypertrophic scar fibroblasts. Moreover, fibronectin expression in the normal fibroblasts was up-regulated after bFGF treatment. bFGF (1000 ng/mL) also induced mitochondrial depolarization in hypertrophic scar fibroblasts (P < 0.01). The cellular ATP level decreased in hypertrophic scar fibroblasts (P < 0.05), while it increased in the normal fibroblasts following treatment with bFGF (P < 0.01). These data suggest that bFGF has differential effects and mechanisms on fibroblasts of the normal skin and hypertrophic scars, indicating that bFGF may play a role in the early phase of skin wound healing and post-burn scar formation.

Prolonged acceptance of skin grafts induced by B cells places regulatory T cells on the histopathology scene

The participation of regulatory T (Treg) cells in B cell-induced T cell tolerance has been claimed in different models. In skin grafts, naive B cells were shown to induce graft tolerance. However, neither the contribution of Treg cells to B cell-induced skin tolerance nor their contribution to the histopathological diagnosis of graft acceptance has been addressed. Here, using male C57BL/6 naive B cells to tolerize female animals, we show that skin graft tolerance is dependent on CD25+ Treg cell activity and independent of B cell-derived IL-10. In fact, B cells from IL-10-deficient mice were able to induce skin graft tolerance while Treg depletion of the host inhibited 100% graft survival. We questioned how Treg cell-mediated tolerance would impact on histopathology. B cell-tolerized skin grafts showed pathological scores as high as a rejected skin from naive, non-tolerized mice due to loss of skin appendages, reduced keratinization and mononuclear cell infiltrate. However, in tolerized mice, 40% of graft infiltrating CD4+ cells were FoxP3+ Treg cells with a high Treg:Teff (effector T cell) ratio (6:1) as compared to non-tolerized mice where Tregs comprise less than 8% of total infiltrating CD4 cells with a Treg:Teff ratio below 1:1. These results render Treg cells an obligatory target for histopathological studies on tissue rejection that may help to diagnose and predict the outcome of a transplanted organ.

Relationship of macrophage migration inhibitory factor levels in PBMCs, lesional skin and serum with disease severity and activity in vitiligo vulgaris

Melanocyte loss in vitiligo vulgaris is believed to be an autoimmune process. Macrophage migration inhibitory factor (MIF) is involved in many autoimmune skin diseases. We determined the possible role of MIF in the pathogenesis of vitiligo vulgaris, and describe the relationship between MIF expressions and disease severity and activity. Serum MIF concentrations and mRNA levels in PBMCs were measured in 44 vitiligo vulgaris patients and 32 normal controls, using ELISA and real-time RT-PCR. Skin biopsies from 15 patients and 6 controls were analyzed by real-time RT-PCR. Values are reported as median (25th-75th percentile). Serum MIF concentrations were significantly increased in patients [35.81 (10.98-43.66) ng/mL] compared to controls [7.69 (6.01-9.03) ng/mL]. MIF mRNA levels were significantly higher in PBMCs from patients [7.17 (3.59-8.87)] than controls [1.67 (1.23-2.42)]. There was also a significant difference in MIF mRNA levels in PBMCs between progressive and stable patients [7.86 (5.85-9.13)vs 4.33 (2.23-8.39)] and in serum MIF concentrations [40.47 (27.71-46.79) vs 26.80 (10.55-36.07) ng/mL]. In addition, the vitiligo area severity index scores of patients correlated positively with changes of both serum MIF concentrations (r = 0.488) and MIF mRNA levels in PBMCs (r = 0.426). MIF mRNA levels were significantly higher in lesional than in normal skin [2.43 (2.13-7.59)vs 1.18 (0.94-1.83)] and in patients in the progressive stage than in the stable stage [7.52 (2.43-8.84)vs 2.13 (1.98-2.64)]. These correlations suggest that MIF participates in the pathogenesis of vitiligo vulgaris and may be useful as an index of disease severity and activity.

Antioxidant effect of 4-nerolidylcatechol and α-tocopherol in erythrocyte ghost membranes and phospholipid bilayers

4-Nerolidylcatechol (4-NC) is found in Pothomorphe umbellataroot extracts and is reported to have a topical protective effect against UVB radiation-induced skin damage, toxicity in melanoma cell lines, and antimalarial activity. We report a comparative study of the antioxidant activity of 4-NC and α-tocopherol against lipid peroxidation initiated by two free radical-generating systems: 2,2′-azobis(2-aminopropane) hydrochloride (AAPH) and FeSO4/H2O2, in red blood cell ghost membranes and in egg phosphatidylcholine (PC) vesicles. Lipid peroxidation was monitored by membrane fluidity changes assessed by electron paramagnetic resonance spectroscopy of a spin-labeled lipid and by the formation of thiobarbituric acid-reactive substances. When lipoperoxidation was initiated by the hydroxyl radical in erythrocyte ghost membranes, both 4-NC and α-tocopherol acted in a very efficient manner. However, lower activities were observed when lipoperoxidation was initiated by the peroxyl radical; and, in this case, the protective effect of α-tocopherol was lower than that of 4-NC. In egg PC vesicles, malondialdehyde formation indicated that 4-NC was effective against lipoperoxidation initiated by both AAPH and FeSO4/H2O2, whereas α-tocopherol was less efficient in protecting against lipoperoxidation by AAPH, and behaved as a pro-oxidant for FeSO4/H2O2. The DPPH (2,2-diphenyl-1-picrylhydrazyl) free-radical assay indicated that two free radicals were scavenged per 4-NC molecule, and one free radical was scavenged per α-tocopherol molecule. These data provide new insights into the antioxidant capacity of 4-NC, which may have therapeutic applications for formulations designed to protect the skin from sunlight irradiation.

Notch ligand Delta-like 1 promotes the metastasis of melanoma by enhancing tumor adhesion

Notch signaling plays a vital role in tumorigenicity and tumor progression by regulating proliferation, invasion, and the tumor microenvironment. Previous research by our group indicated that Notch ligand Delta-like 1 (Dll1) is involved in angiogenesis in melanoma, and we noticed that it took a longer time to trypsinize Dll1-expressing B16 melanoma cells than the control cells. In this article, we extended our study to investigate the effects of Dll1 on tumor cell adhesion and metastasis. Dll1 overexpression activated Notch signaling in B16 tumor cells and significantly enhanced the adhering capacity of B16 tumor cells both in vitro and in vivo. B16-Dll1 cells also had a higher metastatic potential than their counterpart in the mouse model of lung metastasis. Along with increased Dll1 expression, N-cadherin, but not E-cadherin, was upregulated in B16-Dll1 cells. These data suggested that Notch ligand Dll1 may enhance the adhesion and metastasis of melanoma cells by upregulation of N-cadherin.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

High prevalence of methicillin resistance and PVL genes amongStaphylococcus aureus isolates from the nares and skin lesions of pediatric patients with atopic dermatitis

Staphylococcus aureus is highly prevalent among patients with atopic dermatitis (AD), and this pathogen may trigger and aggravate AD lesions. The aim of this study was to determine the prevalence of S. aureus in the nares of pediatric subjects and verify the phenotypic and molecular characteristics of the isolates in pediatric patients with AD. Isolates were tested for antimicrobial susceptibility, SCCmectyping, and Panton-Valentine Leukocidin (PVL) genes. Lineages were determined by pulsed-field gel electrophoresis and multilocus sequence typing (MLST). AD severity was assessed with the Scoring Atopic Dermatitis (SCORAD) index. Among 106 patients, 90 (85%) presented S. aureus isolates in their nares, and 8 also presented the pathogen in their skin infections. Two patients had two positive lesions, making a total of 10 S. aureusisolates from skin infections. Methicillin-resistant S. aureus(MRSA) was detected in 24 (26.6%) patients, and PVL genes were identified in 21 (23.3%), including 6 (75%) of the 8 patients with skin lesions but mainly in patients with severe and moderate SCORAD values (P=0.0095). All 24 MRSA isolates were susceptible to trimethoprim/sulfamethoxazole, while 8 isolates had a minimum inhibitory concentration (MIC) to mupirocin >1024 μg/mL. High lineage diversity was found among the isolates including USA1100/ST30, USA400/ST1, USA800/ST5, ST83, ST188, ST718, ST1635, and ST2791. There was a high prevalence of MRSA and PVL genes among the isolates recovered in this study. PVL genes were found mostly among patients with severe and moderate SCORAD values. These findings can help clinicians improve the therapies and strategies for the management of pediatric patients with AD.

Physical and chemical properties of wami tilapia skin gelatin

Gelatin was extracted from the skin of tilapia (Oreochromis urolepis hornorum) and characterized according to its physical and chemical properties. It had pH 4.66, which is slightly higher than the values reported for gelatins processed by acid solubilization. In general, the ionic content was low, and the average yield of the process was 5.10 g/100 g. The proximal composition of the gelatin was similar to that of the commercial gelatins, with slightly higher moisture content. The tilapia skin gelatin had whitish-yellow color and average turbidity of 67 NTU.

Study of thermodynamic water properties and moisture sorption hysteresis of mango skin

The equilibrium moisture content for adsorption and desorption isotherms of mango skin was determined using the static gravimetric method at temperatures of 20, 26, 33, 38 and 44 oC in the 0.056 to 0.873 water activity range. Both sorption curves show a decrease in equilibrium moisture content as the temperature increasing. The hysteresis effect was observed at constant water activity. The Guggenheim, Anderson, and de Boer (GAB) model presented the best fitting accuracy among a group of models and was used to determine the thermodynamic properties of water sorption. Integral enthalpy and integral entropy areas showed inverted values for the adsorption and desorption isotherms over the wide range of water activity studied. These values confirm, in energetic terms, the difference between adsorption and desorption isotherms observed in the hysteresis phenomenon. Finally, the Gibbs free energy revealed that the sorption process was spontaneous for both sorption isotherms.