Characterization for plant height and flowering date in the biological species oat

The use of wild oat races in artificial hybridization with cultivated oat (Avena sativa L.) has been used as a way of increasing the variability. This work aimed to identify the variability for plant height and flowering date of groups of cultivated oat genotypes, wild introductions of A. fatua L. and segregating populations of natural crosses between A. sativa and A. fatua. Wide genetic variability was observed for both traits in the groups and between them. The wild group of A. fatua L. showed high plants with early maturity, but in the segregating group there was reduced plant height and early maturity. The wild introductions of A. fatua L. studied in this work can be used in oat breeding programs to increase genetic variability by transferring specific characters into the cultivated germ plasm.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Stomatal analysis of citrus somatic hybrids obtained by protoplast fusion

The objective of this work was to evaluate leaf epidermis morphological characteristics of three citrus somatic hybrids, compared to their parents. Parental and somatic hybrid young leaves were collected and processed for scanning electron microscope observations. Citrus polyploid hybrids have fewer stomata per area and these are larger compared to their diploid parental parents. No differences in internal arrangement of the stomatal cells were detected between parental plants and somatic hybrids. Additional studies may determine if these differences will influence physiological behavior of the plants in the field.

Differential gene expression, induced by salicylic acid and Fusarium oxysporum f. sp. lycopersici infection, in tomato

The objective of this work was to determine the transcript profile of tomato plants (Lycopersicon esculentum Mill.), during Fusarium oxysporum f. sp. lycopersici infection and after foliar application of salicylic acid. The suppression subtractive hybridization (SSH) technique was used to generate a cDNA library enriched for transcripts differentially expressed. A total of 307 clones was identified in two subtractive libraries, which allowed the isolation of several defense-related genes that play roles in different mechanisms of plant resistance to phytopathogens. Genes with unknown roles were also isolated from the two libraries, which indicates the possibility of identifying new genes not yet reported in studies of stress/defense response. The SSH technique is effective for identification of resistance genes activated by salicylic acid and F. oxysporum f. sp. lycopersici infection. Not only the application of this technique enables a cost effective isolation of differentially expressed sequences, but also it allows the identification of novel sequences in tomato from a relative small number of sequences.

Combining ability and heterosis in common bean cultivars

The objective of this work was to determine the combining ability and heterosis, for productivity and yield components, in diallel hybrids derived from crossings between BRSMG-Talismã, IPR Uirapuru, FT Soberano, BRS Campeiro, IAC Tybatã, and IPR Juriti parent cultivars. Fifteen hybrids were generated from diallel crosses, excluding reciprocals. The general and specific combining abilities were significant for plant height, number of pods per plant, number of seeds per plant, number of seeds per pod, 50-seed weight, and grain yield, indicating the occurrence of both additive and nonadditive genetic effects. The best strategy to be adopted is the use of BRS Campeiro, FT Soberano and BRSMG-Talismã cultivars in common bean breeding programs involving selection. The most promising combinations were 'IPR Uirapuru' x 'IAC Tybatã', 'IPR Uirapuru' x 'FT Soberano', 'BRS Campeiro' x 'IPR Juriti', and 'BRS Campeiro' x 'IAC Tybatã'. The parents of these hybrids presented high estimates of specific combining abilities. Hybridization of cultivars belonging to distinguished commercial groups propitiates higher heterosis values in the segregant population.

Citrus asymmetric somatic hybrids produced via fusion of gamma-irradiated and iodoacetamide-treated protoplasts

The objective of this study was to produce citrus somatic asymmetric hybrids by fusing gamma-irradiated protoplasts with iodoacetamide-treated protoplasts. Protoplasts were isolated from embryogenic suspension cells of grapefruit (Citrus paradisi Macfad.) cultivars Ruby Red and Flame, sweet oranges (C. sinensis Osbeck) 'Itaboraí', 'Natal', Valencia', and 'Succari', from 'Satsuma' (C. unshiu Marcow.) and 'Changsha' mandarin (C. reticulata Blanco) and 'Murcott' tangor (C. reticulata x C. sinensis). Donor protoplasts were exposed to gamma rays and receptor protoplasts were treated with 3 mmol L-1 iodoacetamide (IOA), and then they were fused for asymmetric hybridization. Asymmetric embryos were germinated, and the resulting shoots were either grafted onto sour orange, rough lemon or 'Swingle' (C. paradisi x Poncirus trifoliata) x 'Sunki' mandarin rootstock seedlings, or rooted after dipping their bases in indol-butyric acid (IBA) solution. The products were later acclimatized to greenhouse conditions. Ploidy was analyzed by flow cytometry, and hybridity was confirmed by amplified fragment length polymorphism (AFLP) analysis of plantlet DNAsamples. The best treatment was the donor-recipient fusion combination of 80 Gy-irradiated 'Ruby Red' protoplasts with 20 min IOA-treated 'Succari' protoplasts. Tetraploid and aneuploid plants were produced. Rooting recalcitrance was solved by dipping shoots' stems in 3,000 mg L-1 IBA solution for 10 min.

Fusion of protoplasts with irradiated microprotoplasts as a tool for radiation hybrid panel in citrus

The objective of this work was to combine asymmetric somatic hybridization (donor-recipient fusion or gamma fusion) to microprotoplast-mediated chromosome transfer, as a tool to be used for chromosome mapping in Citrus. Swinglea glutinosa microprotoplasts were irradiated either with 50, 70, 100 or 200 gamma rays and fused to cv. Ruby Red grapefruit or Murcott tangor protoplasts. Cell colonies were successfully formed and AFLP analyses confirmed presence of S. glutinosa in both 'Murcott' tangor and 'Ruby Red' grapefruit genomes.

Obtaining interspecific hybrids, and molecular analysis by microsatellite markers in grapevine

The objective of this work was to assess the potential of interspecific hybridization of Vitis labruscana and Muscadinia rotundifolia by using artificial cross-pollinations. Microsatellite markers were used to confirm interspecific hybridizations and the identity of the parental genotypes. In crosses in which M. rotundifolia was used as the female parent, no true hybrids were obtained. In the reciprocal crosses, 114 seedlings were identified as true V. labruscana x M. rotundifolia hybrids. Self pollination occurred in direct and in reciprocal crosses. The crossings between 'Bordo' x 'Carlos', 'Magnolia', 'Regale' and' Roanoke', and between' Isabel' x 'Bountiful', 'Carlos', 'Magnolia', 'Regale' and 'Roanoke' were confirmed. The 15 markers evaluated showed that two M. rotundifolia parental genotypes had the same fingerprint profile, indicating a like lyplanting error. The success of hybridization depends mainly on the species and on the cultivar used as the female parent. Microsatellite markers are efficient to confirm the paternity of interspecific F1 hybrids and to determine the correct identity of M. rotundifolia cultivars.

RAPD markers utilization and other parameters in the determination of mango hybrids genitors

Actually mango (Mangifera indica, L.) is considered one of the largest Brazilian fruitbusiness for the export market. Cultivar selection having high fruit quality is a fundamental step to obtain excellent results in this business. A mango breeding program based on intervarietal hybridization may produce new improved cultivars for mango growers. Mango hybrids have been obtained by controlled or open crosses. In the last one, it is important to identify the male parent because it is useful for the genetic cultivar history, thus it is important for planning further improvements. This work presents a parentage test using among others parameters RAPD (Random amplified Polymorphic DNA) markers to estimate the male parent of the selected hybrids in an open cross plot by using five mango cultivars densely planted in a latin square design.

A química medicinal de N-acilidrazonas: novos compostos-protótipos de fármacos analgésicos, antiinflamatórios e anti-trombóticos

In this article are described new bioactive N-acylhydrazone (NAH) derivatives, structurally designed as optimization of aryl hydrazones precursors planned by molecular hybridization of two 5-lipoxigenase inhibitors, e.g. CBS-1108 and BW-755c. The analgesic, antiedematogenic and anti-platelet aggregating profile of several isosteric compounds was investigated by using classic pharmacological assays in vivo and ex-vivo, allowing to identify new potent peripheric analgesic lead, a new anti-inflammatory and an antithrombotic agent. During this study was discovered dozen of active NAH compounds clarifying the structure-activity relationship for this series of NAH derivatives, indicating the pharmacophore character of the N-acylhydrazone functionality.

Sistemas interfaceados de análise por injeção em fluxo e eletroforese capilar (FIA - CE): desafios, aplicações e perspectivas

A review about the state-of-the-art of flow injection analysis (FIA) -- capillary electrophoresis (CE) systems is presented. The basic principles of flow injection and capillary electrophoresis are briefly revised. The main aspects of the FIA-CE hybridization, including advantages and shortcomings, are discussed. Some applications involving all different designs are also presented. This review covers the literature from 1997 up to 2000.

Synthesis, antimicrobial and cytotoxic activities of 5-benzylidene-2-[(pyridine-4-ylmethylene)hydrazono]-thiazolidin-4-one and 2-[(pyridine-4-ylmethylene) hydrazono]-thiazolidin-4-one derivatives

A new series of 5-benzylidene-2-[(pyridine-4-ylmethylene)hydrazono]-thiazolidin-4-ones 4a-l have been synthesized. These compounds were designed by a molecular hybridization approach. 2-[(Pyridine-4-ylmethylene)hydrazono]-thiazolidin-4-ones 3a-d were also obtained and used as intermediates to give the target compounds. The in vitro antimicrobial and cytotoxic activities were evaluated for both series. The intermediate 3b showed considerable antibiotic activity against B. subtilis and C. albicans. In the cytotoxic activity compounds 3b (IC50= 4.25 ± 0.36 µg/mL) and 4l (IC50= 1.38 ± 0.04 µg/mL) were effective for inhibition of human erythromyeloblastoid leukemia (K-562) and human lung carcinoma (NCI-H292) cell lines, respectively.

O ESTADO DA ARTE DA LIGAÇÃO DE HIDROGÊNIO

Along the historical background of science, the hydrogen bond became widely known as the universal interaction, thus playing a key role in many molecular processes. Through the available theoretical approaches, many of these processes can be unveiled on the basis of the molecular parameters of the subject intermolecular system, such as the variation of bond length and mainly the frequency shift observed in the proton donor. Supported by the natural bond analysis (NBO) with the quantification of the hybridization contributions, the structural deformations and vibrational effects cited above are also attributed to the outcome of the intermolecular interaction strength, which consequently can be estimated by means of the quantum theory of atoms in molecules (QTAIM) as well as evaluated by the symmetry-adapted perturbation theory (SAPT). Moreover, to identify the preferential interaction sites for proton donors and acceptors, the molecular electrostatic potential (MEP) is useful in this regard.

Garlic viral complex: identification of Potyviruses and Carlavirus in Central Brazil

Garlic viruses often occur in complex infections in nature. In this study, a garlic virus complex, collected in fields in Brazil, was purified. RT-PCR was performed using specific primers designed from the consensus regions of the coat protein genes of Onion yellow dwarf virus, a garlic strain (OYDV-G) and Leek yellow stripe virus (LYSV). cDNA of Garlic common latent virus (GCLV) was synthesized using oligo-dT and random primers. By these procedures individual garlic virus genomes were isolated and sequenced. The nucleotide sequence analysis associated with serological data reveals the presence of two Potyvirus OYDV-G and LYSV, and GCLV, a Carlavirus, simultaneously infecting garlic plants. Deduced amino acid sequences of the Brazilian isolates were compared with related viruses reported in different geographical regions of the world. The analysis showed closed relations considering the Brazilian isolates of OYDV-G and GCLV, and large divergence considering LYSV isolate. The detection of these virus species was confirmed by specific reactions observed when coat protein genes of the Brazilian isolates were used as probes in dot-blot and Southern blot hybridization assays. In field natural viral re-infection of virus-free garlic was evaluated.