133 resultados para Goodenough’s human figure test
Resumo:
It has been reported that patients with progressive tuberculosis (TB) express abundant amounts of the antimicrobial peptides (AMPs) cathelicidin (LL-37) and human neutrophil peptide-1 (HNP-1) in circulating cells, whereas latent TB infected donors showed no differences when compared with purified protein derivative (PPD) and QuantiFERON®-TB Gold (QFT)-healthy individuals. The aim of this study was to determine whether LL-37 and HNP-1 production correlates with higher tuberculin skin test (TST) and QFT values in TB household contacts. Twenty-six TB household contact individuals between 26-58 years old TST and QFT positive with at last two years of latent TB infection were recruited. AMPs production by polymorphonuclear cells was determined by flow cytometry and correlation between TST and QFT values was analysed. Our results showed that there is a positive correlation between levels of HNP-1 and LL-37 production with reactivity to TST and/or QFT levels. This preliminary study suggests the potential use of the expression levels of these peptides as biomarkers for progression in latent infected individuals.
Resumo:
The human beta defensin 1 (hBD-1) antimicrobial peptide is a member of the innate immune system known to act in the first line of defence against microorganisms, including viruses such as human papillomavirus (HPV). In this study, five functional polymorphisms (namely g-52G>A, g-44C>G and g-20G>A in the 5’UTR and c.*5G>A and c.*87A>G in the 3’UTR) in the DEFB1 gene encoding for hBD-1 were analysed to investigate the possible involvement of these genetic variants in susceptibility to HPV infection and in the development of HPV-associated lesions in a population of Brazilian women. The DEFB1 g-52G>A and c.*5G>A single-nucleotide polymorphisms (SNPs) and the GCAAA haplotype showed associations with HPV-negative status; in particular, the c.*5G>A SNP was significantly associated after multiple test corrections. These findings suggest a possible role for the constitutively expressed beta defensin-1 peptide as a natural defence against HPV in the genital tract mucosa.
Resumo:
The interferon (IFN)-γ response to peptides can be a useful diagnostic marker of Mycobacterium tuberculosis (MTB) latent infection. We identified promiscuous and potentially protective CD4+ T-cell epitopes from the most conserved regions of MTB antigenic proteins by scanning the MTB antigenic proteins GroEL2, phosphate-binding protein 1 precursor and 19 kDa antigen with the TEPITOPE algorithm. Seven peptide sequences predicted to bind to multiple human leukocyte antigen (HLA)-DR molecules were synthesised and tested with IFN-γ enzyme-linked immunospot (ELISPOT) assays using peripheral blood mononuclear cells (PBMCs) from 16 Mantoux tuberculin skin test (TST)-positive and 16 TST-negative healthy donors. Eighty-eight percent of TST-positive donors responded to at least one of the peptides, compared to 25% of TST-negative donors. Each individual peptide induced IFN-γ production by PBMCs from at least 31% of the TST-positive donors. The magnitude of the response against all peptides was 182 ± 230 x 106 IFN-γ spot forming cells (SFC) among TST-positive donors and 36 ± 62 x 106 SFC among TST-negative donors (p = 0.007). The response to GroEL2 (463-477) was only observed in the TST-positive group. This combination of novel MTB CD4 T-cell epitopes should be tested in a larger cohort of individuals with latent tuberculosis (TB) to evaluate its potential to diagnose latent TB and it may be included in ELISPOT-based IFN-γ assays to identify individuals with this condition.
Resumo:
Human herpesvirus 6 (HHV-6) may cause severe complications after haematopoietic stem cell transplantation (HSCT). Monitoring this virus and providing precise, rapid and early diagnosis of related clinical diseases, constitute essential measures to improve outcomes. A prospective survey on the incidence and clinical features of HHV-6 infections after HSCT has not yet been conducted in Brazilian patients and the impact of this infection on HSCT outcome remains unclear. A rapid test based on real-time quantitative polymerase chain reaction (qPCR) has been optimised to screen and quantify clinical samples for HHV-6. The detection step was based on reaction with TaqMan® hydrolysis probes. A set of previously described primers and probes have been tested to evaluate efficiency, sensitivity and reproducibility. The target efficiency range was 91.4% with linearity ranging from 10-106 copies/reaction and a limit of detection of five copies/reaction or 250 copies/mL of plasma. The qPCR assay developed in the present study was simple, rapid and sensitive, allowing the detection of a wide range of HHV-6 loads. In conclusion, this test may be useful as a practical tool to help elucidate the clinical relevance of HHV-6 infection and reactivation in different scenarios and to determine the need for surveillance.
Resumo:
A test-chamber (K&L-Chamber) made of cardboard and acrylic plastic, and consisting in four sections (A, B, C and D) was developed by Klowden & Lea (1978) for Aedes aegypti host-seeking behavior studies. Later, Foster & Lutes (1985) also used an identical chamber to successfully evaluate the efficacy of electronic repellers. It was described here a modified K&L-Chamber for behavioral studies of Ae. aegypti adults. The chamber was made in polystyrene, consisting of three sections (A, B and C) and using a human hand and a fluorescent lamp as stimulus to attract the mosquitoes. The suitability of the present test-chamber was validated assaying 80 replicates and releasing 10 Ae. aegypti females in each replicate. The females were released in the section A and allowed to fly to the section C. A mean of 96.0% (s.e. 0.213) Ae. aegypti females successfully reached section C. The present test-chamber is cheaper and easier to handle and as efficient as K&L-Chamber, when compared to Foster & Lutes (1978) that noticed 93.8% of Ae. aegypti reaching the trap section.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
A liquid chromatography method was developed and validated for the determination of phenobarbital in human plasma using phenytoin as internal standard. The drugs were extracted from plasma by liquid-liquid extraction and separated isocratically on a C12 analytical column, maintained at 35 ºC, with water:acetonitrile:methanol (58.8:15.2:26, v/v/v) as mobile phase, run at a flow rate of 1.2 mL/min with detection at 205 nm. The method was linear in the range of 0.1-4 μg/mL (r²=0.9999) and demonstrated acceptable results for the precision, accuracy and stability studies. The method was successfully applied for the bioequivalence study of two tablet formulations (test and reference) of phenobarbital 100 mg after single oral dose administration to healthy human volunteers.
Resumo:
Objective To compare the diagnostic accuracy of the classic Meisels cytologic criteria and the Schneider secondary criteria relative to the hybrid capture method for diagnosing HPV infection. Methods This was a retrospective study performed at a public university hospital. A total of 41 patients with a cytologic diagnosis of HPV infection and 40 HPV-negative patients were selected for review of the cervical-vaginal smears seeking to classical and secondary criteria. A single pathologist reviewed the slides in search of the criteria. The classical and secondary cytologic criteria were compared with the hybrid capture for diagnosing HPV infection. Bartleti test was applied for the age analysis, and Fisher's exact test was used to compare proportions. The tests were considered significant when the probability of rejecting the null hypothesis was less than 5% (p < 0.05). Results The Meisels criteria were less sensitive (34.0%) than the secondary Schneider criteria (57.5%) when compared with the hybrid capture (p < 0.0001), although the specificity of the former criteria was non-significantly higher (91.2% and 67.7%, respectively). In cases of moderate or intense inflammation, the sensitivity and specificity of the Schneider criteria were decreased, 33.3% and 50.0% respectively (p = 0.0115). Conclusions Compared with hybrid capture for diagnosis of HPV infection, the sensitivity of the secondary Schneider criteria was higher than the classical Meisels criteria.Moderate or intense inflammation reduces the sensitivity and specificity of the secondary Schneider criteria for diagnosing HPV infection using the hybrid capture as the gold standard.
Resumo:
Toxoplasma gondii (Nicolle et Manceaux, 1909) is an obligatory intracellular protozoan parasite of warm animals, including human and non-human primates. Domestic and wild felids are considered definitive hosts. Several authors have already identified lesions in New World primates caused by T. gondii. Nevertheless, little is known about serological studies on those animals. With this reason, New World non-human primates of the genera Cebus and Callithrix that were apprehended by governmental authorities and sent to the Wildlife Screening Center (Cetas)/IBAMA, at the municipality of Seropédica, state of Rio Janeiro, were bled and sera were submitted to the indirect hemagglutination test for detection of anti-T. gondii antibodies. From 21 sera of Cebus primates, 76.19% (16/21) had anti-T. gondii antibodies. Titles varied from 16 to 2048. In samples from 21 Callithrix, only 4.5% (1/22) had anti-T. gondii antibodies. Only one animal had a title of 32. During all the time those animals were clinical evaluated until sample was collected; none of them had any clinical sign or sequel related to infection by T. gondii. The fact that the origin of these primates is unknown and that there is no information about their feeding habits before captivity makes it difficult to determine the source of T. gondii infection.
Resumo:
The possibility that Ureaplasma urealyticum might play an important role in human infertility was first raised more than 20 years ago, but this association remains speculative. Considering the hypothesis that the pathogenicity of Ureaplasma urealyticum may depend on its serotypes, the clastogenic effects of different strains of Ureaplasma urealyticum, at concentrations of 103 CCU (color changing units)/ml, 104 CCU/ml and 105 CCU/ml, were evaluated in vitro in short-term cultures of human lymphocytes. Total or partial mitotic inhibition was produced by Ureaplasma urealyticum serotypes 2, 3 and 10 independent of the concentration (103 CCU/ml, 104 CCU/ml or 105 CCU/ml) of the microorganisms employed. In contrast, the clastogenic effects observed with serotypes 1, 7 and 12 varied according to the concentration employed in the test. Mitotic alterations were observed in Ureaplasma urealyticum serotypes 5, 6, 7, 8, 9, 11 and 12. Chromatid gaps (53.0%) and chromatid breaks (13.9%) were the most frequent types of alterations observed. The results of this in vitro assay demonstrated that the clastogenic effects varied with the Ureaplasma urealyticum serotypes evaluated
Resumo:
Fetal hemoglobin was measured in HIV1/2 patients under treatment with combined therapy (zidovudine and a protease inhibitor). A total of 143 patients and 103 normal individuals were investigated by the quantitative method of Betke and the semi-quantitative acid elution method of Kleihauer. In the normal person, hemoglobin F makes up less than 1% and an increase higher than 1.5% was observed in 21.4% of HIV patients by the method of Betke and in 24.8% of HIV-infected patients by the method of Kleihauer. The quantitative biochemical method of Betke showed that the populations were significantly different (two-tailed Mann-Whitney test). The reason for this hemoglobin F increase might be ascribed to the effect of zidovudine or to direct viral action on gamma chain expression. The finding of a higher F cell frequency indicated by the method of Kleihauer rather suggests that there is an increased F cell clone proliferation rather than an increase in hemoglobin F level in every cell.
Resumo:
In the present study we evaluated the precision of the ELISA method to quantify caffeine in human plasma and compared the results with those obtained by gas chromatography. A total of 58 samples were analyzed by gas chromatography using a nitrogen-phosphorus detector and routine techniques. For the ELISA test, the samples were diluted to obtain a concentration corresponding to 50% of the absorbance of the standard curve. To determine whether the proximity between the I50 of the standard curve and that of the sample would bring about a more precise result, the samples were divided into three blocks according to the criterion of difference, in modulus, of the I50 of the standard curve and of the I50 of the sample. The samples were classified into three groups. The first was composed of 20 samples with I50 up to 1.5 ng/ml, the second consisted of 21 samples with I50 ranging from 1.51 to 3 ng/ml, and the third of 17 samples with I50 ranging from 3.01 to 13 ng/ml. The determination coefficient (R² = 0.999) showed that the data obtained by gas chromatography represented a reliable basis. The results obtained by ELISA were also reliable, with an estimated Pearson correlation coefficient of 0.82 between the two methods. This coefficient for the different groups (0.88, 0.79 and 0.49 for groups 1, 2 and 3, respectively) showed greater reliability for the test with dilutions closer to I50.
Resumo:
Osteoporosis is a common manifestation of Cushing's syndrome, but the mechanisms responsible for this abnormality have not been defined. With the objective of analyzing parathyroid hormone (PTH) secretion in chronic hypercortisolism (CH), we evaluated 11 healthy subjects and 8 patients with CH, 6 with Cushing's disease and 2 with adrenal adenoma. These volunteers were submitted to tests of PTH stimulation through hypocalcemia (EDTA), PTH suppression through hypercalcemia (iv and oral calcium), and evaluation of bone mineral density (BMD) by DEXA. During the test of PTH stimulation, the calcium and magnesium concentrations of the normal and CH groups were similar. Patients with CH showed an increased PTH response to the hypocalcemic stimulus compared to controls. PTH values were significantly higher in the CH group at 70 (17.5 ± 3.5 vs 10.2 ± 1.3 pmol/l, P = 0.04), and 120 min (26.1 ± 5.9 vs 11.3 ± 1.9 pmol/l, P = 0.008) of EDTA infusion. The area under the curve for PTH during EDTA infusion was also significantly higher in patients with CH than in normal subjects (1867 ± 453 and 805 ± 148 pmol l-1 2 h-1, P = 0.02). During the test of PTH suppression, calcium, magnesium and PTH levels of the patients with hypercortisolism and controls were similar. BMD was decreased in patients with hypercortisolism in the spine (0.977 ± 0.052 vs 1.205 ± 0.038 g/cm² in controls, P<0.01). In conclusion, our results show that subjects with CH present decreased bone mass mainly in trabecular bone. The use of dynamic tests permitted the detection of increased PTH secretion in response to a hypocalcemic stimulus in CH patients that may probably be involved in the occurrence of osteoporosis in this state.
Resumo:
The break point of the curve of blood lactate vs exercise load has been called anaerobic threshold (AT) and is considered to be an important indicator of endurance exercise capacity in human subjects. There are few studies of AT determination in animals. We describe a protocol for AT determination by the "lactate minimum test" in rats during swimming exercise. The test is based on the premise that during an incremental exercise test, and after a bout of maximal exercise, blood lactate decreases to a minimum and then increases again. This minimum value indicates the intensity of the AT. Adult male (90 days) Wistar rats adapted to swimming for 2 weeks were used. The initial state of lactic acidosis was obtained by making the animals jump into the water and swim while carrying a load equivalent to 50% of body weight for 6 min (30-s exercise interrupted by a 30-s rest). After a 9-min rest, blood was collected and the incremental swimming test was started. The test consisted of swimming while supporting loads of 4.5, 5.0, 5.5, 6.0 and 7.0% of body weight. Each exercise load lasted 5 min and was followed by a 30-s rest during which blood samples were taken. The blood lactate minimum was determined from a zero-gradient tangent to a spline function fitting the blood lactate vs workload curve. AT was estimated to be 4.95 ± 0.10% of body weight while interpolated blood lactate was 7.17 ± 0.16 mmol/l. These results suggest the application of AT determination in animal studies concerning metabolism during exercise.
Resumo:
This review covers the effect of drugs affecting anxiety using four psychological procedures for inducing experimental anxiety applied to healthy volunteers and patients with anxiety disorders. The first is aversive conditioning of the skin conductance responses to tones. The second is simulated public speaking, which consists of speaking in front of a video camera, with anxiety being measured with psychometric scales. The third is the Stroop Color-Word test, in which words naming colors are painted in the same or in a different shade, the incongruence generating a cognitive conflict. The last test is a human version of a thoroughly studied animal model of anxiety, fear-potentiated startle, in which the eye-blink reflex to a loud noise is recorded. The evidence reviewed led to the conclusion that the aversive conditioning and potentiated startle tests are based on classical conditioning of anticipatory anxiety. Their sensitivity to benzodiazepine anxiolytics suggests that these models generate an emotional state related to generalized anxiety disorder. On the other hand, the increase in anxiety determined by simulated public speaking is resistant to benzodiazepines and sensitive to drugs affecting serotonergic neurotransmission. This pharmacological profile, together with epidemiological evidence indicating its widespread prevalence, suggests that the emotional state generated by public speaking represents a species-specific response that may be related to social phobia and panic disorder. Because of scant pharmacological data, the status of the Stroop Color-Word test remains uncertain. In spite of ethical and economic constraints, human experimental anxiety constitutes a valuable tool for the study of the pathophysiology of anxiety disorders.