Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

N-partitioning, nitrate reductase and glutamine synthetase activities in two contrasting varieties of maize

In order to identify useful parameters for maize genetic breeding programs aiming at a more efficient use of N, two maize varieties of contrasting N efficiency, Sol da Manhã NF (efficient) and Catetão (inefficient) were compared. Experiments were carried out under field and greenhouse conditions, at low and high N levels. The parameters analysed included total and relative plant and grain N content, biomass and the activities of nitrate reductase and glutamine synthetase in different parts of the plant. It was found that the translocation efficiency of N and photoassimilates to the developing seeds and the source-sink relations were significantly different for the two varieties. N content of the whole plant and grain, cob weight and the relative ear dry weight were useful parameters for characterizing the variety Sol da Manhã NF as to its efficient use of N. Enzymes activity of glutamine synthetase (transferase reaction) and nitrate reductase did not differ among the varieties.

Sugarcane crop efficiency in two growing seasons in São Paulo State, Brazil

A conceptual framework for crop production efficiency was derived using thermodynamic efficiency concept, in order to generate a tool for performance evaluation of agricultural systems and to quantify the interference of determining factors on this performance. In Thermodynamics, efficiency is the ratio between the output and input of energy. To establish this relationship in agricultural systems, it was assumed that the input energy is represented by the attainable crop yield, as predicted through simulation models based on environmental variables. The method of FAO's agroecological zones was applied to the assessment of the attainable sugarcane yield, while Instituto Brasileiro de Geografia e Estatística (IBGE) data were used as observed yield. Sugarcane efficiency production in São Paulo state was evaluated in two growing seasons, and its correlation with some physical factors that regulate production was calculated. A strong relationship was identified between crop production efficiency and soil aptitude. This allowed inferring the effect of agribusiness factors on crop production efficiency. The relationships between production efficiency and climatic variables were also quantified and indicated that solar radiation, annual rainfall, water deficiency, and maximum air temperature are the main factors affecting the sugarcane production efficiency.

QTL mapping for protein content in soybean cultivated in two tropical environments

The objectives of this study were to detect quantitative trait loci (QTL) for protein content in soybean grown in two distinct tropical environments and to build a genetic map for protein content. One hundred eighteen soybean recombinant inbred lines (RIL), obtained from a cross between cultivars BARC 8 and Garimpo, were used. The RIL were cultivated in two distinct Brazilian tropical environments: Cascavel county, in Paraná, and Viçosa county, in Minas Gerais (24º57'S, 53º27'W and 20º45'S, 42º52'W, respectively). Sixty-six SSR primer pairs and 65 RAPD primers were polymorphic and segregated at a 1:1 proportion. Thirty poorly saturated linkage groups were obtained, with 90 markers and 41 nonlinked markers. For the lines cultivated in Cascavel, three QTL were mapped in C2, E and N linkage groups, which explained 14.37, 10.31 and 7.34% of the phenotypic variation of protein content, respectively. For the lines cultivated in Viçosa, two QTL were mapped in linkage groups G and #1, which explained 9.51 and 7.34% of the phenotypic variation of protein content. Based on the mean of the two environments, two QTL were identified: one in the linkage group E (9.90%) and other in the group L (7.11%). In order for future studies to consistently detect QTL effects of different environments, genotypes with greater stability should be used.

Conductivity test in seeds of different passion flower species

The objective of this work was to evaluate the use of the conductivity test as a means of predicting seed viability in seven Passiflora species: P. alata, P. cincinnata, P. edulis f. edulis, P. edulis f. flavicarpa, P. morifolia, P. mucronata, and P. nitida. Conductivity of non-desiccated (control), desiccated, and non-desiccated cryopreserved seeds was determined and related to their germination percentage. The obtained results suggest that the electrical conductivity test has potential as a germination predictor for P. edulis f. flavicarpa seed lots, but not for the other tested species.

Persistent organic pollutants in two reservoirs along the Paraíba do Sul-Guandu River system, Rio de Janeiro, Brazil

Sediment contamination is evaluated by determining organic micropollutants (organochlorine compounds - OCs and polycyclic aromatic hydrocarbons - PAHs) in two important Brazilian water reservoirs. Trace levels of OCs were observed in the Santana reservoir (44.8 ng g-1 d.w. of p,p'-DDT), while in the Funil reservoir the levels were below detection level. Forty-eight percent of the found sigmaocs were polychlorinated biphenyls, 29% dichlorodiphenyltrichloroethane (DDT), 18% Drins, and 5% other pesticides (HCB, Heptachlor, Heptachlor-epoxide, gamma-HCH and a-Endosulfan). We observed lower levels of sigmaPAH in the Funil reservoir (1 to 275 ng g-1d.w.) than in the Santana reservoir (2.2 to 26.7 µg g-1 d.w.).

Comparison of GC and HPLC for quantification of organic acids in two jaboticaba (Myrciaria) fruit varieties

Gas chromatography (GC) with trimethylsilyl derivative formation was compared to high-performance liquid chromatography (HPLC) for quantification of organic acids (OAs) in two jaboticaba (Myrciaria) fruit (pulp and pericarp) varieties (Sabará and Açu Paulista). Succinic and citric acids were the major OAs found in all the samples analyzed. Besides being much more tedious, the results obtained with GC were significantly lower than HPLC (p<0.05) when the data (acids, variety, two parts and flowering days) were considered together. The presence of both acids was confirmed by gas chromatography-mass spectrometry (GC-MS).

Can affinity interactions influence the partitioning of glucose-6-phosphate dehydrogenase in two-phase aqueous micellar systems?

In this work, we provide an investigation of the role and strength of affinity interactions on the partitioning of the glucose-6-phosphate dehydrogenase in aqueous two-phase micellar systems. These systems are constituted of micellar surfactant solutions and offer both hydrophobic and hydrophilic environments, providing selectivity to biomolecules. We studied G6PD partitioning in systems composed of the nonionic surfactants, separately, in the presence and absence of affinity ligands. We observed that G6PD partitions to the micelle-poor phase, owing to the strength of excluded-volume interactions in these systems that drive the protein to the micelle-poor phase, where there is more free volume available.

Chemical composition of volatiles from male and female specimens of Baccharis trimera collected in two distant regions of southern brazil: a comparative study using chemometrics

GC/MS/FID analyses of volatile compounds from cladodes and inflorescences from male and female specimens of Baccharis trimera (Less.) DC. collected in the states of Paraná and Santa Catarina, Brazil, showed that carquejyl acetate was the primary volatile component (38% to 73%), while carquejol and ledol were identified in lower concentrations. Data were subjected to hierarchical cluster analysis and principal component analysis, which confirmed that the chemical compositions of all samples were similar. The results presented here highlight the occurrence of the same chemotype of B. trimera in three southern states of Brazil.

Gender Might Be Factor for Student Admission in Two Brazilian Medical Schools

This is a secondary data-based study conducted to investigate whether gender is related to acceptance. Two Brazilian Medical Schools, Universities A and B, were studied. Their entrance exams (EE) were analysed and the number of candidates who took the EE was compared to the number of students admitted to the MS according to gender, in the period between 1995 and 2009. The same data from MS in the United States in 2011 was also evaluated. There was an increase in the percentage of female applicants but it did not correspond to the percentage of admitted students of the same gender. There was a trend of selecting men. At A, 39.3% of the applicants and 47% of the admitted students were men (OR = 1.37; CI95% = 1.24 – 1.51). In B, men represented 39.3% of the applicants and 65.4% of the admitted students (OR = 2.93; CI 95% = 2.76 – 3.11). This was not seen in US MS. The analysis of the EE suggests that the greater selection of men could be a product of EE format.

Canopy openness and lai estimates in two seasonally deciduous forests on limestone outcrops in central Brazil using hemispherical photographs

Patches of seasonally dry tropical forests occur on limestone outcrops in Central Brazil surrounded by the dominant savanna vegetation. They contain valuable timber species but are threatened by farming and mining activities. The objective of this study was to describe canopy opening and light relations in two seasonally deciduous dry forests on slopes and limestone outcrops, in the Paranã valley at the northeastern region of the Goiás state, Brazil. The studied forests were in the Fazenda Sabonete in Iaciara-Go and Fazenda Forquilha in Guarani-GO. Woody plants were sampled in 25 (20 x 20 m) plots in each forest. In the Sabonete forest 40 species, 705 ind./ha-1 with a basal area of 15.78 m²/ha-1 were found, while in Forquilha there were 55 species, 956 ind./ha-1 with a basal area of 24.76 m²/ha-1. Using hemispherical photographic techniques, 25 black and white photographs were taken at each site, during the dry season, totaling 50 photographs. These were taken at the beginning of each vegetation-sampling plot. The photographs were scanned in grey tones and saved as 'Bitmap'. The canopy opening and leaf area index (LAI) were calculated using the software Winphot. The mean canopy opening was 54.0% (±9.36) for Fazenda Sabonete and 64.6% (±11.8) in Fazenda Forquilha, with both sites presenting significant differences in the opening estimates (P < 0.05). Their floristic richness and structure also differed with the more open canopy forest, Forquilha, being richer and denser, suggesting the need for further studies on species-environment relationships in these forests.

DYNAMICS AND PREDICTION OF DIAMETRIC STRUCTURE IN TWO ATLANTIC FOREST FRAGMENTS IN NORTHEASTERN BRAZIL

ABSTRACT Monitoring analyses aim to understand the processes that drive changes in forest structure and, along with prediction studies, may assist in the management planning and conservation of forest remnants. The objective of this study was to analyze the forest dynamics in two Atlantic rainforest fragments in Pernambuco, Brazil, and to predict their future forest diameter structure using the Markov chain model. We used continuous forest inventory data from three surveys in two forest fragments of 87 ha (F1) and 388 ha (F2). We calculated the annual rates of mortality and recruitment, the mean annual increment, and the basal area for each of the 3-year periods. Data from the first and second surveys were used to project the third inventory measurements, which were compared to the observed values in the permanent plots using chi-squared tests (a = 0.05). In F1, a decrease in the number of individuals was observed due to mortality rates being higher than recruitment rates; however, there was an increase in the basal area. In this fragment, the fit to the Markov model was adequate. In F2, there was an increase in both the basal area and the number of individuals during the 6-year period due to the recruitment rate exceeding the mortality rate. For this fragment, the fit of the model was unacceptable. Hence, for the studied fragments, the demographic rates influenced the stem density more than the floristic composition. Yet, even with these intense dynamics, both fragments showed active growth.

Effects of water deficit in two phenological stages on production of japanese cucumber cultived in greenhouse

The experiment was performed in the experimental area of the Engineering Department Federal University of Lavras, Minas Gerais State, Brazil. It aimed at identifying the adequate irrigation management of the greenhouse-cultivated Japanese cucumber (Cucumis sativus L.). complete randomized design, with four levels of soil water potential (15; 30; 60 e 120 kPa) at two phenological phases (vegetative and reproductive), and 5 replications. Overall, the results showed decrease of yield according to increase of soil water potentials. During the reproductive stage, Japanese cucumber plants were more sensitive to water deficit, resulting in further decrease in yield compared to applied water deficit during the vegetative stage of the culture.

Spatial variability of soil physical properties in two management systems in sugarcane crop

The aim of this study was to characterize the spatial variability of soil bulk density (Bd), soil moisture content (θ) and total porosity (Tp) in two management systems of sugarcane harvesting, with or without burning, in a Haplustox soil, in the 0-0.20 m layer. The study area is located in Rio Brilhante, state of Mato Grosso do Sul, Brazil, in Eldorado Sugar Mill. The plots have presented 180 m length, and 145.6 m width, totaling 90 points distributed in the form of a grid of nine rows by ten columns, with points spaced 20 m from its neighbor. Soil samples were collected at 0-0.20 m layer in 2007/2008 and 2008/2009 crops. The harvest with burning system had a higher density compared to mechanized harvest, in the two study periods. The moisture content as well as the porosity increased proportionally with the decrease of the density of the harvest burning system compared to the mechanized.

Seasonality of net radiation in two sub-basins of Paracatu by the use of modis sensor products

The net radiation (Rn) represents the main source of energy for physical and chemical processes that occur in the surface-atmosphere interface, and it is used for air and soil heating, water transfer, in the form of vapor from the surface to the atmosphere, and for the metabolism of plants, especially photosynthesis. If there is no record of net radiation in certain areas, the use of information is important to help determine it. Among them we can highlight those provided by remote sensing. In this context, this work aims to estimate the net radiation, with the use of products of MODIS sensor, in the sub-basins of Entre Ribeiros creek and Preto River, located between the Brazilian states of Goiás and Minas Gerais. The SEBAL (Surface Energy Balance Algorithm for Land) was used to obtain the Rn in four different days in the period of July to October, 2007. The Rn results obtained were consistent with others cited in the literature and are important because the orbital information can help determine the Rn in areas where there are not automatic weather stations to record the net radiation.