Cloning, bioinformatics analysis, and expression of the dust mite allergen Der f 5 of Dermatophagoides farinae

Crude extracts of house dust mites are used clinically for diagnosis and immunotherapy of allergic diseases, including bronchial asthma, perennial rhinitis, and atopic dermatitis. However, crude extracts are complexes with non-allergenic antigens and lack effective concentrations of important allergens, resulting in several side effects. Dermatophagoides farinae (Hughes; Acari: Pyroglyphidae) is one of the predominant sources of dust mite allergens, which has more than 30 groups of allergen. The cDNA coding for the group 5 allergen of D. farinae from China was cloned, sequenced and expressed. According to alignment using the VECTOR NTI 9.0 software, there were eight mismatched nucleotides in five cDNA clones resulting in seven incompatible amino acid residues, suggesting that the Der f 5 allergen might have sequence polymorphism. Bioinformatics analysis revealed that the matured Der f 5 allergen has a molecular mass of 13604.03 Da, a theoretical pI of 5.43 and is probably hydrophobic and cytoplasmic. Similarities in amino acid sequences between Der f 5 and allergens of other domestic mite species, viz. Der p 5, Blo t 5, Sui m 5, and Lep d 5, were 79, 48, 53, and 37%, respectively. Phylogenetic analysis indicated that Der f 5 and Der p 5 clustered together. Blo t 5 and Ale o 5 also clustered together, although Blomia tropicalis and Aleuroglyphus ovatus belong to different mite families, viz. Echimyopodidae and Acaridae, respectively.

Whole transcriptome organisation in the dehydrated supraoptic nucleus

The supraoptic nucleus (SON) is part of the central osmotic circuitry that synthesises the hormone vasopressin (Avp) and transports it to terminals in the posterior lobe of the pituitary. Following osmotic stress such as dehydration, this tissue undergoes morphological, electrical and transcriptional changes to facilitate the appropriate regulation and release of Avp into the circulation where it conserves water at the level of the kidney. Here, the organisation of the whole transcriptome following dehydration is modelled to fit Zipf's law, a natural power law that holds true for all natural languages, that states if the frequency of word usage is plotted against its rank, then the log linear regression of this is -1. We have applied this model to our previously published euhydrated and dehydrated SON data to observe this trend and how it changes following dehydration. In accordance with other studies, our whole transcriptome data fit well with this model in the euhydrated SON microarrays, but interestingly, fit better in the dehydrated arrays. This trend was observed in a subset of differentially regulated genes and also following network reconstruction using a third-party database that mines public data. We make use of language as a metaphor that helps us philosophise about the role of the whole transcriptome in providing a suitable environment for the delivery of Avp following a survival threat like dehydration.

Myocardial ischemic preconditioning upregulated protein 1(Mipu1):zinc finger protein 667 - a multifunctional KRAB/C2H2 zinc finger protein

Myocardial ischemic preconditioning upregulated protein 1 (Mipu1) is a newly discovered upregulated gene produced in rats during the myocardial ischemic preconditioning process. Mipu1 cDNA contains a 1824-base pair open reading frame and encodes a 608 amino acid protein with an N-terminal Krüppel-associated box (KRAB) domain and classical zinc finger C2H2 motifs in the C-terminus. Mipu1 protein is located in the cell nucleus. Recent studies found that Mipu1 has a protective effect on the ischemia-reperfusion injury of heart, brain, and other organs. As a nuclear factor, Mipu1 may perform its protective function through directly transcribing and repressing the expression of proapoptotic genes to repress cell apoptosis. In addition, Mipu1 also plays an important role in regulating the gene expression of downstream inflammatory mediators by inhibiting the activation of activator protein-1 and serum response element.

The consensus sequence of FAMLF alternative splice variants is overexpressed in undifferentiated hematopoietic cells

The familial acute myeloid leukemia related factor gene (FAMLF) was previously identified from a familial AML subtractive cDNA library and shown to undergo alternative splicing. This study used real-time quantitative PCR to investigate the expression of the FAMLF alternative-splicing transcript consensus sequence (FAMLF-CS) in peripheral blood mononuclear cells (PBMCs) from 119 patients with de novo acute leukemia (AL) and 104 healthy controls, as well as in CD34+cells from 12 AL patients and 10 healthy donors. A 429-bp fragment from a novel splicing variant of FAMLF was obtained, and a 363-bp consensus sequence was targeted to quantify total FAMLF expression. Kruskal-Wallis, Nemenyi, Spearman's correlation, and Mann-Whitney U-tests were used to analyze the data. FAMLF-CS expression in PBMCs from AL patients and CD34+ cells from AL patients and controls was significantly higher than in control PBMCs (P<0.0001). Moreover,FAMLF-CS expression in PBMCs from the AML group was positively correlated with red blood cell count (rs=0.317, P=0.006), hemoglobin levels (rs=0.210, P=0.049), and percentage of peripheral blood blasts (rs=0.256, P=0.027), but inversely correlated with hemoglobin levels in the control group (rs=–0.391, P<0.0001). AML patients with high CD34+ expression showed significantly higherFAMLF-CS expression than those with low CD34+ expression (P=0.041). Our results showed thatFAMLF is highly expressed in both normal and malignant immature hematopoietic cells, but that expression is lower in normal mature PBMCs.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Partial characterization of genes from the embryonic axis of Melanoxylon brauna Schott. (Leguminosae-Caesalpinioideae) seeds

The objective of this study was to partially characterize some genes involved in the desiccation tolerance of the embryonic axis of Melanoxylon brauna seeds subjected, or not, to oven fast-drying. Seeds were initially dried rapidly in an oven at 40 ºC, 50 ºC, 60 ºC, 70 ºC, and 80 °C, for 24, 48 and 72 h and then subjected to germination tests and moisture content determination. Degenerate primers were designed for 19 genes. The CDNA was used as a template for PCR amplifications using the degenerate primers, and the PCR products obtained were purified, cloned and sequenced. The seeds showed a gradual reduction in percent germination with increasing temperature and drying time. Nucleotide sequences of the cloned fragments related to genes CAT1, SPS1, Abi5, Transk and PM25 were obtained. The similarity analysis with the sequences deposited in databases revealed similarities with genes CAT1, SPS1, Transk and PM25 from other plant species. The nucleotide sequences obtained from the respective genes will be used for designing specific primers for gene expression analyses during seed germination in order to understand the causes for loss of physiological quality of Melanoxylon brauna seeds.