Identification of sarcopenic obesity in postmenopausal women: a cutoff proposal

Sarcopenic obesity is the combination of reduced fat-free mass (FFM) and increased fat mass (FM) with advancing age but there is lack of clear criteria for its identification. The purposes of the present investigation were: 1) to determine the prevalence of postmenopausal women with reduced FFM relative to their FM and height, and 2) to examine whether there are associations between the proposed classification and health-related variables. A total of 607 women were included in this cross-sectional study and were separated into two subsets: 258 older women with a mean age of 66.8 ± 5.6 years and 349 young women aged 18-40 years (mean age, 29.0 ± 7.5 years). All volunteers underwent body composition assessment by dual-energy X-ray absorptiometry. The FFM index relative to FM and height was calculated and the cutoff value corresponded to two standard deviations below the mean of the young reference group. To examine the clinical significance of the classification, all older participants underwent measurements of quadriceps strength and cardiorespiratory fitness. Values were compared between those who were classified as low FFM or not, using an independent samples t-test and correlations were examined. The cutoff corresponded to a residual of -3.4 and generated a sarcopenic obesity prevalence of 19.8% that was associated with reduced muscle strength and aerobic fitness among the older participants. Also, the index correlated significantly with the health-related fitness variables. The results demonstrated reduced functional capacity for those below the proposed cutoff and suggested applicability of the approach as a definition for sarcopenic obesity.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Downregulation of TIM-3 mRNA expression in peripheral blood mononuclear cells from patients with systemic lupus erythematosus

The T-cell immunoglobulin and mucin domain (TIM) family is associated with autoimmune diseases, but its expression level in the immune cells of systemic lupus erythematosus (SLE) patients is not known. The aim of this study was to investigate whether the expression of TIM-3 mRNA is associated with pathogenesis of SLE. Quantitative real-time reverse transcription-polymerase chain reaction analysis (qRT-PCR) was used to determine TIM-1, TIM-3, and TIM-4 mRNA expression in peripheral blood mononuclear cells (PBMCs) from 132 patients with SLE and 62 healthy controls. The PBMC surface protein expression of TIMs in PBMCs from 20 SLE patients and 15 healthy controls was assayed by flow cytometry. Only TIM-3 mRNA expression decreased significantly in SLE patients compared with healthy controls (P<0.001). No significant differences in TIM family protein expression were observed in leukocytes from SLE patients and healthy controls (P>0.05). SLE patients with lupus nephritis (LN) had a significantly lower expression of TIM-3 mRNA than those without LN (P=0.001). There was no significant difference in the expression of TIM-3 mRNA within different classes of LN (P>0.05). Correlation of TIM-3 mRNA expression with serum IgA was highly significant (r=0.425, P=0.004), but was weakly correlated with total serum protein (rs=0.283, P=0.049) and serum albumin (rs=0.297, P=0.047). TIM-3 mRNA expression was weakly correlated with the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI; rs=-0.272, P=0.032). Our results suggest that below-normal expression of TIM-3 mRNA in PBMC may be involved in the pathogenesis of SLE.

CTLA4 enhances the osteogenic differentiation of allogeneic human mesenchymal stem cells in a model of immune activation

Allogeneic mesenchymal stem cells (allo-MSCs) have recently garnered increasing interest for their broad clinical therapy applications. Despite this, many studies have shown that allo-MSCs are associated with a high rate of graft rejection unless immunosuppressive therapy is administered to control allo-immune responses. Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) is a co-inhibitory molecule expressed on T cells that mediates the inhibition of T-cell function. Here, we investigated the osteogenic differentiation potency of allo-MSCs in an activated immune system that mimics the in vivo allo-MSC grafting microenvironment and explored the immunomodulatory role of the helper T cell receptorCTLA4 in this process. We found that MSC osteogenic differentiation was inhibited in the presence of the activated immune response and that overexpression of CTLA4 in allo-MSCs suppressed the immune response and promoted osteogenic differentiation. Our results support the application of CTLA4-overexpressing allo-MSCs in bone tissue engineering.