Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

High prevalence of methicillin resistance and PVL genes amongStaphylococcus aureus isolates from the nares and skin lesions of pediatric patients with atopic dermatitis

Staphylococcus aureus is highly prevalent among patients with atopic dermatitis (AD), and this pathogen may trigger and aggravate AD lesions. The aim of this study was to determine the prevalence of S. aureus in the nares of pediatric subjects and verify the phenotypic and molecular characteristics of the isolates in pediatric patients with AD. Isolates were tested for antimicrobial susceptibility, SCCmectyping, and Panton-Valentine Leukocidin (PVL) genes. Lineages were determined by pulsed-field gel electrophoresis and multilocus sequence typing (MLST). AD severity was assessed with the Scoring Atopic Dermatitis (SCORAD) index. Among 106 patients, 90 (85%) presented S. aureus isolates in their nares, and 8 also presented the pathogen in their skin infections. Two patients had two positive lesions, making a total of 10 S. aureusisolates from skin infections. Methicillin-resistant S. aureus(MRSA) was detected in 24 (26.6%) patients, and PVL genes were identified in 21 (23.3%), including 6 (75%) of the 8 patients with skin lesions but mainly in patients with severe and moderate SCORAD values (P=0.0095). All 24 MRSA isolates were susceptible to trimethoprim/sulfamethoxazole, while 8 isolates had a minimum inhibitory concentration (MIC) to mupirocin >1024 μg/mL. High lineage diversity was found among the isolates including USA1100/ST30, USA400/ST1, USA800/ST5, ST83, ST188, ST718, ST1635, and ST2791. There was a high prevalence of MRSA and PVL genes among the isolates recovered in this study. PVL genes were found mostly among patients with severe and moderate SCORAD values. These findings can help clinicians improve the therapies and strategies for the management of pediatric patients with AD.

Microbiological quality of hamburgers sold in the streets of Cuiabá - MT, Brazil and vendor hygiene-awareness

This study evaluated the microbiological quality of hamburgers and the microbe community on the hands of vendors in Cuiabá, Mato Grosso, Brazil, in relation to vendors´ awareness as to what constitute acceptable food-handling practices as part of a broad-spectrum research programme on street foods in Brazil . Sale of the hamburger known as the 'baguncinha' is common and widespread in urban Cuiabá, Mato Grosso, Brazil. Food inspectors encounter various difficulties in carrying out inspections. One hundred and five hamburgers samples were evaluated using conventional methods including tests for facultative aerobic and/or anaerobic mesophytic bacteria, coliform counts at 45 °C, the coagulase test for Staphylococcus, Gram-staining for the presence of Bacillus cereus, Clostridium sulphite reductase and Salmonella spp. The hamburgers were categorized as unsuitable for human consumption in 31.4% of samples, with those testing positive for coliforms and Staphylococcus at unacceptably high levels by Brazilian standards. High levels of microbiological contamination were detected on the hands of the food handlers and mesophytic bacterial counts reached 1.8 × 10(4) CFU/hand. Interviews were carried out by means of questionnaires to evaluate levels of awareness as to acceptable food handling practices and it was found that 80,1% of vendors had never participated in any kind of training.

Physical and chemical properties of wami tilapia skin gelatin

Gelatin was extracted from the skin of tilapia (Oreochromis urolepis hornorum) and characterized according to its physical and chemical properties. It had pH 4.66, which is slightly higher than the values reported for gelatins processed by acid solubilization. In general, the ionic content was low, and the average yield of the process was 5.10 g/100 g. The proximal composition of the gelatin was similar to that of the commercial gelatins, with slightly higher moisture content. The tilapia skin gelatin had whitish-yellow color and average turbidity of 67 NTU.

Study of thermodynamic water properties and moisture sorption hysteresis of mango skin

The equilibrium moisture content for adsorption and desorption isotherms of mango skin was determined using the static gravimetric method at temperatures of 20, 26, 33, 38 and 44 oC in the 0.056 to 0.873 water activity range. Both sorption curves show a decrease in equilibrium moisture content as the temperature increasing. The hysteresis effect was observed at constant water activity. The Guggenheim, Anderson, and de Boer (GAB) model presented the best fitting accuracy among a group of models and was used to determine the thermodynamic properties of water sorption. Integral enthalpy and integral entropy areas showed inverted values for the adsorption and desorption isotherms over the wide range of water activity studied. These values confirm, in energetic terms, the difference between adsorption and desorption isotherms observed in the hysteresis phenomenon. Finally, the Gibbs free energy revealed that the sorption process was spontaneous for both sorption isotherms.