Psoriasis severity and hypothalamic-pituitary-adrenal axis function: results from the CALIPSO study

Psoriasis is a chronic inflammatory disease that significantly impacts life quality, being associated with stress and mental disorders. We investigated whether the activity of the hypothalamic-pituitary-adrenal (HPA) axis was associated with psoriasis severity, daily life stress and anxiety, and depressive symptoms. In this ancillary study, which was part of the CALIPSO (coronary artery calcium in psoriasis) study, saliva was collected from 102 patients with psoriasis immediately upon awakening, 30, and 60 min after awakening, at 2:00 pm and at bedtime (five time points) to determine salivary cortisol levels. We used Pearson's correlation coefficient to evaluate the association of clinical and psychopathological variables with HPA activity. We found a direct correlation between bedtime cortisol and psoriasis severity evaluated by the psoriasis area severity index (PASI; r=0.39, P<0.001). No correlations between other clinical and psychopathological variables or with other cortisol assessments were observed. The findings indicated that HPA dysfunction may be present in psoriasis, as bedtime cortisol was correlated with psoriasis severity. Our study is limited by the lack of a control group; therefore, we were not able to explore whether these cortisol values were different compared with a concurrent, healthy sample.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Correlations between forced oscillation technique parameters and pulmonary densitovolumetry values in patients with acromegaly

The aims of this study were to evaluate the forced oscillation technique (FOT) and pulmonary densitovolumetry in acromegalic patients and to examine the correlations between these findings. In this cross-sectional study, 29 non-smoking acromegalic patients and 17 paired controls were subjected to the FOT and quantification of lung volume using multidetector computed tomography (Q-MDCT). Compared with the controls, the acromegalic patients had a higher value for resonance frequency [15.3 (10.9-19.7) vs 11.4 (9.05-17.6) Hz, P=0.023] and a lower value for mean reactance [0.32 (0.21-0.64) vs 0.49 (0.34-0.96) cm H2O/L/s2, P=0.005]. In inspiratory Q-MDCT, the acromegalic patients had higher percentages of total lung volume (TLV) for nonaerated and poorly aerated areas [0.42% (0.30-0.51%) vs 0.25% (0.20-0.32%), P=0.039 and 3.25% (2.48-3.46%) vs 1.70% (1.45-2.15%), P=0.001, respectively]. Furthermore, the acromegalic patients had higher values for total lung mass in both inspiratory and expiratory Q-MDCT [821 (635-923) vs 696 (599-769) g, P=0.021 and 844 (650-945) vs 637 (536-736) g, P=0.009, respectively]. In inspiratory Q-MDCT, TLV showed significant correlations with all FOT parameters. The TLV of hyperaerated areas showed significant correlations with intercept resistance (rs=−0.602, P<0.001) and mean resistance (rs=−0.580, P<0.001). These data showed that acromegalic patients have increased amounts of lung tissue as well as nonaerated and poorly aerated areas. Functionally, there was a loss of homogeneity of the respiratory system. Moreover, there were correlations between the structural and functional findings of the respiratory system, consistent with the pathophysiology of the disease.

Diabetes mellitus affects the biomechanical function of the callus and the expression of TGF-beta1 and BMP2 in an early stage of fracture healing

Transforming growth factor beta 1 (TGF-β1) and bone morphogenetic protein-2 (BMP-2) are important regulators of bone repair and regeneration. In this study, we examined whether TGF-β1 and BMP-2 expressions were delayed during bone healing in type 1 diabetes mellitus. Tibial fractures were created in 95 diabetic and 95 control adult male Wistar rats of 10 weeks of age. At 1, 2, 3, 4, and 5 weeks after fracture induction, five rats were sacrificed from each group. The expressions of TGF-β1 and BMP2 in the fractured tibias were measured by immunohistochemistry and quantitative reverse-transcription polymerase chain reaction, weekly for the first 5 weeks post-fracture. Mechanical parameters (bending rigidity, torsional rigidity, destruction torque) of the healing bones were also assessed at 3, 4, and 5 weeks post-fracture, after the rats were sacrificed. The bending rigidity, torsional rigidity and destruction torque of the two groups increased continuously during the healing process. The diabetes group had lower mean values for bending rigidity, torsional rigidity and destruction torque compared with the control group (P<0.05). TGF-β1 and BMP-2 expression were significantly lower (P<0.05) in the control group than in the diabetes group at postoperative weeks 1, 2, and 3. Peak levels of TGF-β1 and BMP-2 expression were delayed by 1 week in the diabetes group compared with the control group. Our results demonstrate that there was a delayed recovery in the biomechanical function of the fractured bones in diabetic rats. This delay may be associated with a delayed expression of the growth factors TGF-β1 and BMP-2.

Correlation between heart rate variability and pulmonary function adjusted by confounding factors in healthy adults

The autonomic nervous system maintains homeostasis, which is the state of balance in the body. That balance can be determined simply and noninvasively by evaluating heart rate variability (HRV). However, independently of autonomic control of the heart, HRV can be influenced by other factors, such as respiratory parameters. Little is known about the relationship between HRV and spirometric indices. In this study, our objective was to determine whether HRV correlates with spirometric indices in adults without cardiopulmonary disease, considering the main confounders (e.g., smoking and physical inactivity). In a sample of 119 asymptomatic adults (age 20-80 years), we evaluated forced vital capacity (FVC) and forced expiratory volume in 1 s (FEV1). We evaluated resting HRV indices within a 5-min window in the middle of a 10-min recording period, thereafter analyzing time and frequency domains. To evaluate daily physical activity, we instructed participants to use a triaxial accelerometer for 7 days. Physical inactivity was defined as <150 min/week of moderate to intense physical activity. We found that FVC and FEV1, respectively, correlated significantly with the following aspects of the RR interval: standard deviation of the RR intervals (r =0.31 and 0.35), low-frequency component (r =0.38 and 0.40), and Poincaré plot SD2 (r =0.34 and 0.36). Multivariate regression analysis, adjusted for age, sex, smoking, physical inactivity, and cardiovascular risk, identified the SD2 and dyslipidemia as independent predictors of FVC and FEV1 (R2=0.125 and 0.180, respectively, for both). We conclude that pulmonary function is influenced by autonomic control of cardiovascular function, independently of the main confounders.

Effects of disturbed blood flow during exercise on endothelial function: a time course analysis

This study aimed to examine the time course of endothelial function after a single handgrip exercise session combined with blood flow restriction in healthy young men. Nine participants (28±5.8 years) completed a single session of bilateral dynamic handgrip exercise (20 min with 60% of the maximum voluntary contraction). To induce blood flow restriction, a cuff was placed 2 cm below the antecubital fossa in the experimental arm. This cuff was inflated to 80 mmHg before initiation of exercise and maintained through the duration of the protocol. The experimental arm and control arm were randomly selected for all subjects. Brachial artery flow-mediated dilation (FMD) and blood flow velocity profiles were assessed using Doppler ultrasonography before initiation of the exercise, and at 15 and 60 min after its cessation. Blood flow velocity profiles were also assessed during exercise. There was a significant increase in FMD 15 min after exercise in the control arm compared with before exercise (64.09%±16.59%, P=0.001), but there was no change in the experimental arm (-12.48%±12.64%, P=0.252). FMD values at 15 min post-exercise were significantly higher for the control arm in comparison to the experimental arm (P=0.004). FMD returned to near baseline values at 60 min after exercise, with no significant difference between arms (P=0.424). A single handgrip exercise bout provoked an acute increase in FMD 15 min after exercise, returning to near baseline values at 60 min. This response was blunted by the addition of an inflated pneumatic cuff to the exercising arm.

Thermophysical and rheological properties of dulce de leche with and without coconut flakes as a function of temperature

Dulce de leche (DL), a dairy dessert highly appreciated in Brazil, is a concentrated product containing about 70% m/m of total solids. Thermophysical and rheological properties of two industrial Brazilian Dulce de leche formulations (classic Dulce de leche and Dulce de leche added with coconut flakes 1.5% m/m) were determined at temperatures comprised between 28.4 and 76.4 °C. In general, no significant differences (p < 0.05) were observed in the presence of coconut flakes in the two formulations. Heat capacity varied from 2633.2 to 3101.8 J/kg.°C; thermal conductivity from 0.383 to 0.452 W/m.°C; specific mass from 1350.7 to 1310.7 kg/m³; and, thermal diffusivity from (1.082 × 10-7 to 1.130 × 10-7) m²/s. The Bingham model was used to properly describe the non-Newtonian behavior of both formulations, with yielding stress values varying from 27.3 to 17.6 Pa and plastic viscosity from 19.9 to 5.9 Pa.s.

Oxidative enzymes activity in sugarcane juice as a function of the planting system

In Brazil, the largest producer of sugarcane in the world, the industrial process transforms this crop into ethanol and/or granulated sugar. Some cultivars exhibit enzymatic browning in the extracted sugarcane juice at levels harmful to the manufacturing process of white granulated sugar. The objective of this study was to assess the effect of sugarcane straw used as soil coverage, the use of different planting systems, and treatments with hydrogel polymer on enzymatic activity. The cultivar RB 86 7515 was sampled for 8 months; the first sample was obtained by cutting the upper portion of the stalk at the internode, which was taken to the laboratory for determination of the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The soil coverage with different forms of straw as well as the planting systems did not change the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The polyphenoloxidase (PPO) activity increased with the use of a polymer due to increased polyphenoloxidase (PPO) activity in the groove system. The enzymes studied showed changes in activity during the experimental period. The production of sugar at the end of the season (August to November) avoids the periods of highest enzymatic activity.

Evaluation of metabolic syndrome and associations with inflammation and graft function in renal transplant recipients

INTRODUCTION: Cardiovascular disease (CVD) is a major determinant of mortality in renal transplant recipients (RTR). Metabolic syndrome (MS) and chronic inflammation are currently considered non traditional risk factors for cardiovascular disease. This study evaluates the frequency of these conditions their associations with graft function. OBJECTIVE: To evaluate the prevalence of metabolic syndrome (MS) and inflammation and their associations with graft function in renal transplant recipients. METHODS: A cross-sectional study was carried out with 200 RTR. MS was defined by the NCEP-ATP III criteria. Inflammation was assessed by CRP levels. Renal function was assessed by GFR estimation using the MDRD equation. RESULTS: MS occurred in 71 patients (35.5%). Patients with MS had higher CPR and decreased GFR levels. Inflammation was present in 99 patients (49.5%). Mean waist perimeter, body mass index, triglycerides and serum total cholesterol were significantly higher in inflamed patients. An association between MS and inflammation was demonstrated, 48 (67.6%) patients with MS were inflamed and among those without MS the rate of inflamed patients was 39.5% (51 patients) (p < 0.001). A significantly higher percentage of patients with MS in the group of patients in chronic renal disease stages III and IV was observed. CONCLUSION: In RTR there is a significant association among MS and inflammation. MS is negatively associated with graft function. The clinical implications of these findings must be evaluated in longitudinal studies.

Histopathological analysis of pre-implantation donor kidney biopsies: association with graft survival and function in one year post-transplantation

Introduction: Pre-implantation kidney biopsy is a decision-making tool when considering the use of grafts from deceased donors with expanded criteria, implanting one or two kidneys and comparing this to post-transplantation biopsies. The role of histopathological alterations in kidney compartments as a prognostic factor in graft survival and function has had conflicting results. Objective: This study evaluated the prevalence of chronic alterations in pre-implant biopsies of kidney grafts and the association of findings with graft function and survival in one year post-transplant. Methods: 110 biopsies were analyzed between 2006 and 2009 at Santa Casa de Porto Alegre, including live donors, ideal deceased donors and those with expanded criteria. The score was computed according to criteria suggested by Remuzzi. The glomerular filtration rate (GFR) was calculated using the abbreviated MDRD formula. Results: No statistical difference was found in the survival of donors stratified according to Remuzzi criteria. The GFR was significantly associated with the total scores in the groups with mild and moderate alterations, and in the kidney compartments alone, by univariate analysis. The multivariate model found an association with the presence of arteriosclerosis, glomerulosclerosis, acute rejection and delayed graft function. Conclusion: Pre-transplant chronic kidney alterations did not influence the post-transplantation one-year graft survival, but arteriosclerosis and glomerulosclerosis is predictive of a worse GFR. Delayed graft function and acute rejection are independent prognostic factors.