108 resultados para Human genetics -- Moral and ethical aspects
Resumo:
Abstract:Trematodes belonging to the family Eucotylidae, including Tanaisia(Paratanaisia)bragaiSantos, 1934are parasites of the kidney and ureter that affect several species of domestic and wild birds. Tanaisia bragaiis considered a low pathogenic parasite, but high worm burdens may determine clinical complications, including signs of apathy, weight loss, diarrhea and death. This paper describes the first report of infection by T. bragai in peacocks (Pavo cristatus), which constitutes a new host record and offers data on the lesions associated to this parasitism, although the degree of pathogenicity and parasite load may be considered mild. These birds did not exhibit clinical signs of parasitism. The macroscopic exam revealed discreet yellow spots on the liver. In the histological sections of the kidney, specimens of T. bragai were found in the collecting ducts, which were markedly dilated, with a thickened wall. Other findings included a mild inflammatory reaction in the wall of the ducts (but sometimes absent), flattening of lining epithelial cells and small, multifocal points of calcification around the collecting ducts. The microscopic examination of the parasites revealed trematodes with an elongated body, well-developed sub terminal oral sucker, pharynx present, short esophagus, cecum somewhat undulating or not, with blind end, testes symmetrical, equatorial, irregular in shape or slightly lobed, vitelline fields extending in both pre-ovarian and post ovarian fields, uterus very long, intercecal or sometimes overlapping the cecum and containing large quantities of eggs. The present findings suggest the need for further diagnostic studies on the prevalence of this trematode in peacocks as well as pathologic studies for the determination of the potential pathogenicity of this parasite in this species of bird. Moreover, infected peacocks could serve as carriers of T. bragai to be transferred to other bird species, thereby contributing to the dispersion of the parasite.
Resumo:
Abstract A 4-year-old female captive-bred snake of the genus Bothrops showed swelling on the left side of the oral cavity, suggesting the development of neoplasia. The mass was removed surgically and sent for pathological examination. Two months later a new increase in volume in the same site was observed, suggesting recurrence. The lesion was completely removed and sent for pathological analysis. Histologically, the two-samples consisted of a mass with highly-cell density composed of spindle-shaped anaplastic cells arranged in interwoven bundles, distributed throughout the tissue extension and, occasionally, polygonal cells arranged in irregular fascicles. The Masson trichrome staining showed modest amount of collagen supporting the neoplastic cells. PAS-positive content was not observed in the cytoplasm of neoplastic cells. Histological and histochemical findings indicated that it was a spindle cell neoplasm, but the classification was not possible. Immunohistochemistry was requested and performed using the streptavidin-biotin-peroxidase method. The markers used were anti-vimentin, anti-PCNA, anti-EMA, anti-melan A and anti-melanosome, anti-desmin, anti-actin, anti-CD68 and anti- S100protein. The neoplastic cells were immunoreactive for vimentin and PCNA and negative for the other antibodies. The morphology characterization, histochemical and immunohistochemical analysis of neoplastic cells allowed the definitive diagnosis of oral fibrosarcoma.
Resumo:
Abstract: Mammary gland tumors are the most common type of tumors in bitches but research on survival time after diagnosis is scarce. The purpose of this study was to investigate the relationship between survival time after mastectomy and a number of clinical and morphological variables. Data was collected retrospectively on bitches with mammary tumors seen at the Small Animal Surgery Clinic Service at the University of Brasília. All subjects had undergone mastectomy. Survival analysis was conducted using Cox's proportional hazard method. Of the 139 subjects analyzed, 68 died and 71 survived until the end of the study (64 months). Mean age was 11.76 years (SD=2.71), 53.84% were small dogs. 76.92% of the tumors were malignant, and 65.73% had both thoracic and inguinal glands affected. Survival time in months was associated with age (hazard rate ratios [HRR] =1.23, p-value =1.4x10-4), animal size (HRR between giant and small animals =2.61, p-value =0.02), nodule size (HRR =1.09, p-value =0.03), histological type (HRR between solid carcinoma and carcinoma in a mixed tumor =2.40, p-value =0.02), time between diagnosis and surgery (TDS, with HRR =1.21, p-value =2.7x10-15), and the interaction TDS*follow-up time (HRR =0.98, p-value =1.6x10-11). The present study is one of the few on the subject matter. Several important covariates were evaluated and age, animal size, nodule size, histological type, TDS and TDS*follow up time were identified as significantly associated to survival time.
Resumo:
A. peregrina var. falcata form mutualistic symbiosis with arbuscular mycorrhizal fungus. An anatomical and ultrastructural study was carried out to analyze some aspects of this simbiotic association as well as some root features. The results evidenced the presence of fibers with non-lignified thicked secondary walls in the stele and sparse papillae on root surface. A. peregrina var. falcata mycorrhizas presented features of Arum-type (intercellular hyphae) and Paris-type (extensive coils) arbuscular mycorrhiza. Their general appearance with extraradical hyphae, intracellular coils, intercellular hyphae and arbuscules, is in agreement with arbuscular mycorrhizas of several plants. The ultrastructural observations showed that in intercellular hyphae and arbuscules vacuoles were dominant and that in rough endoplasmatic reticulum and small vesicles seems to be associated with arbuscule senescence process.
Resumo:
Samples of healthy leaves and galls induced by Schizomyia macrocapillata Maia on Bauhinia brevipes Vogel were submitted to routine techniques to investigate gall anatomy and development. Pouch galls are induced on the abaxial surface of unfolded immature leaves, and become spheroid with long reddish hairs covering their external surface. Galls occur isolated or coalesce when in larger numbers. Gall development was divided into six phases: 1) initiation; 2) tissue re-arrangement; 3) tissue differentiation; 4) maturation; 5) growth phase; and 6) dehiscence. This last phase corresponds to gall senescence, which takes place just after the larva exits the chamber to pupate. An important developmental phase of tissue reorientation was recorded after the initiation phase. The presence of hyphae close to the covering layer characterizes this gall as an ambrosia gall and the feeding mode of the gall migde is discussed. Few hyphae were found during the first developmental phases and fungi may play an important role during gall morphogenesis. Neoformed trichomes may provide not only photoprotection but also protection against natural enemies and water loss. The neoformation of phloematic bundles suggests host manipulation and indicates the establishment of a deviating sink.
Resumo:
The vasorelaxant effects of SR 47063 (4-(2-cyanimino-1,2-dihydropyrid-1-yl)-2,2-dimethyl-6-nitrochromene), a new K+-channel opener structurally related to levcromakalim, were examined in isolated human saphenous vein (HSV) and rat aorta (RA). HSV or RA rings were precontracted with either KCl or noradrenaline and cumulative relaxant concentration-response curves were obtained for SR 47063 (0.1 nM to 1 µM) in the presence or absence of 3 µM glibenclamide. SR 47063 potently relaxed HSV and RA precontracted with 20 mM (but not 60 mM) KCl or 10 µM noradrenaline in a concentration-dependent manner, showing slightly greater activity in the aorta. The potency of the effect of SR 47063 on HSV and RA was 12- and 58-fold greater, respectively, than that reported for the structurally related K+-channel opener levcromakalim. The vasorelaxant action of SR 47063 in both blood vessels was strongly inhibited by 3 µM glibenclamide, consistent with a mechanism of action involving ATP-dependent K+-channels.
Resumo:
Osteoporosis is a multifactorial disease with great impact on morbidity and mortality mainly in postmenopausal women. Although it is recognized that factors related to life-style and habits may influence bone mass formation leading to greater or lower bone mass, more than 85% of the variation in bone mineral density (BMD) is genetically determined. The collagen type I alpha 1 (COLIA1) gene is a possible risk factor for osteoporosis. We studied a population of 220 young women from the city of São Paulo, Brazil, with respect to BMD and its correlation with both COLIA1 genotype and clinical aspects. The distribution of COLIA1 genotype SS, Ss and ss in the population studied was 73.6, 24.1 and 2.3%, respectively. No association between these genotypes and femoral or lumbar spine BMD was detected. There was a positive association between lumbar spine BMD and weight (P<0.0001), height (P<0.0156), and body mass index (BMI) (P<0.0156), and a negative association with age at menarche (P<0.0026). There was also a positive association between femoral BMD and weight (P<0.0001), height (P<0.0001), and BMI (P<0.0001), and a negative correlation with family history for osteoporosis (P<0.041). There was no association between the presence of allele s and reduced BMD. We conclude that a family history of osteoporosis and age at menarche are factors that may influence bone mass in our population.
Resumo:
In the present paper we discuss the development of "wave-front", an instrument for determining the lower and higher optical aberrations of the human eye. We also discuss the advantages that such instrumentation and techniques might bring to the ophthalmology professional of the 21st century. By shining a small light spot on the retina of subjects and observing the light that is reflected back from within the eye, we are able to quantitatively determine the amount of lower order aberrations (astigmatism, myopia, hyperopia) and higher order aberrations (coma, spherical aberration, etc.). We have measured artificial eyes with calibrated ametropia ranging from +5 to -5 D, with and without 2 D astigmatism with axis at 45º and 90º. We used a device known as the Hartmann-Shack (HS) sensor, originally developed for measuring the optical aberrations of optical instruments and general refracting surfaces in astronomical telescopes. The HS sensor sends information to a computer software for decomposition of wave-front aberrations into a set of Zernike polynomials. These polynomials have special mathematical properties and are more suitable in this case than the traditional Seidel polynomials. We have demonstrated that this technique is more precise than conventional autorefraction, with a root mean square error (RMSE) of less than 0.1 µm for a 4-mm diameter pupil. In terms of dioptric power this represents an RMSE error of less than 0.04 D and 5º for the axis. This precision is sufficient for customized corneal ablations, among other applications.
Resumo:
The etiopathogenesis of vulvar intraepithelial neoplasia (VIN III) and invasive squamous cell carcinoma are largely unknown. Since there are few studies on Brazilian patients, our purpose was to determine the frequency of human papillomavirus (HPV) infection and the expression of p53 in these lesions, and associate them with other factors such as age, morphological subtypes, multicentric and multifocal disease. Thirty-eight cases of VIN III, nine of superficially invasive carcinoma, and 55 of invasive vulvar carcinoma were retrospectively evaluated from 1983 to 1995 for the presence of HPV by immunohistochemistry and in situ hybridization, and for p53 protein expression by immunohistochemistry on paraffin sections. All cases for whom material (slides and paraffin blocks) and clinical data were available were included. HPV and p53 were detected in 57.9 and 21.1% of the VIN III lesions, 33.3 and 66.7% of superficially invasive carcinomas, and 7.3 and 58.2% of invasive squamous cell carcinomas, respectively. HPV infection was associated with younger age in the VIN III and invasive carcinoma groups. In the latter, HPV infection was associated with the basaloid variant. p53 expression rate was higher in superficially invasive and invasive lesions and was not related to HPV infection. Our findings are similar to others and support the hypothesis that there are two separate entities of the disease, one associated with HPV and the other unrelated, with p53 inactivation possibly being implicated in some of the cases.
Resumo:
Children with chronic renal failure in general present growth retardation that is aggravated by corticosteroids. We describe here the effects of methylprednisolone (MP) and recombinant human growth hormone (rhGH) on the growth plate (GP) of uremic rats. Uremia was induced by subtotal nephrectomy in 30-day-old rats, followed by 20 IU kg-1 day-1 rhGH (N = 7) or 3 mg kg-1 day-1 MP (N = 7) or 20 IU kg-1 day-1 rhGH + 3 mg kg-1 day-1 MP (N = 7) treatment for 10 days. Control rats with intact renal function were sham-operated and treated with 3 mg kg-1 day-1 MP (N = 7) or vehicle (N = 7). Uremic rats (N = 7) were used as untreated control animals. Structural alterations in the GP and the expression of anti-proliferating cell nuclear antigen (PCNA) and anti-insulin-like growth factor I (IGF-I) by epiphyseal chondrocytes were evaluated. Uremic MP rats displayed a reduction in the proliferative zone height (59.08 ± 4.54 vs 68.07 ± 7.5 µm, P < 0.05) and modifications in the microarchitecture of the GP. MP and uremia had an additive inhibitory effect on the proliferative activity of GP chondrocytes, lowering the expression of PCNA (19.48 ± 11.13 vs 68.64 ± 7.9% in control, P < 0.0005) and IGF-I (58.53 ± 0.96 vs 84.78 ± 2.93% in control, P < 0.0001), that was counteracted by rhGH. These findings suggest that in uremic rats rhGH therapy improves longitudinal growth by increasing IGF-I synthesis in the GP and by stimulating chondrocyte proliferation.
Resumo:
Women living in Latin American countries bear a disproportionate burden of cervical cancer, a condition caused by infection with the human papillomavirus (HPV). We performed a study in Santa Elena, Guayas (currently Santa Elena Province), Ecuador, to determine how often HPV could be detected in women attending a private cancer screening clinic. Participants underwent a Pap test, and vaginal and cervical swabs were performed for HPV testing by the polymerase chain reaction (PCR). Each participant completed a verbally administered survey. The mean age of 302 participants was 37.7 years (range 18 to 78 years). The majority of cervical and vaginal specimens contained sufficient DNA to perform PCR. Overall, 24.2% of the participants had either a cervical or vaginal swab that tested positive for HPV. In general, there was a good correlation between the HPV types detected in the cervical and vaginal swabs from the participants, but vaginal swabs were more likely to contain HPV DNA than were cervical swabs. The high-risk HPV types 16, 52, 58, and 59 and the low-risk HPV types 62, 71, 72, and 83 were the most frequently detected HPV types. The number of lifetime sexual partners was positively associated with detection of any HPV type, detection of oncogenic HPV, and abnormal Pap smears. Further studies are needed to determine if these results are representative of all Ecuadorian women and to determine if cervical cancers in Ecuadorian women are caused by the same HPV types found in the swab specimens obtained in this study.
Resumo:
Esophageal cancer is a prevalent cancer worldwide. Some studies have reported the possible etiology of human papillomavirus (HPV) in benign and malignant papillomas of the esophagus but the conclusions are controversial. In the present study, we investigated an esophageal papilloma from a 30-year-old male patient presenting aphasia. HPV DNA was detected by generic PCR using MY09/11 primers, and restriction fragment length polymorphism revealed the presence of HPV54, usually associated with benign genital lesions. Hypermethylation of the pINK4A gene was also investigated due to its relation to malignant transformation, but no modification was detected in the host gene. Except for an incipient reflux, no risk factors such as cigarette smoking, alcohol abuse or an infected sexual partner were recorded. Since esophageal lesions may have a malignant potential, HPV detection and typing are useful tools for patient follow-up.
Resumo:
Preimplantation genetic diagnosis (PGD) was originally developed to diagnose embryo-related genetic abnormalities for couples who present a high risk of a specific inherited disorder. Because this technology involves embryo selection, the medical, bioethical, and legal implications of the technique have been debated, particularly when it is used to select features that are not related to serious diseases. Although several initiatives have attempted to achieve regulatory harmonization, the diversity of healthcare services available and the presence of cultural differences have hampered attempts to achieve this goal. Thus, in different countries, the provision of PGD and regulatory frameworks reflect the perceptions of scientific groups, legislators, and society regarding this technology. In Brazil, several texts have been analyzed by the National Congress to regulate the use of assisted reproduction technologies. Legislative debates, however, are not conclusive, and limited information has been published on how PGD is specifically regulated. The country requires the development of new regulatory standards to ensure adequate access to this technology and to guarantee its safe practice. This study examined official documents published on PGD regulation in Brazil and demonstrated how little direct oversight of PGD currently exists. It provides relevant information to encourage reflection on a particular regulation model in a Brazilian context, and should serve as part of the basis to enable further reform of the clinical practice of PGD in the country.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.