DNA multigene sequencing of topotypic specimens of the fascioliasis vector Lymnaea diaphana and phylogenetic analysis of the genus Pectinidens (Gastropoda)

Freshwater lymnaeid snails are crucial in defining transmission and epidemiology of fascioliasis. In South America, human endemic areas are related to high altitudes in Andean regions. The species Lymnaea diaphana has, however, been involved in low altitude areas of Chile, Argentina and Peru where human infection also occurs. Complete nuclear ribosomal DNA 18S, internal transcribed spacer (ITS)-2 and ITS-1 and fragments of mitochondrial DNA 16S and cytochrome c oxidase (cox)1 genes of L. diaphana specimens from its type locality offered 1,848, 495, 520, 424 and 672 bp long sequences. Comparisons with New and Old World Galba/Fossaria, Palaearctic stagnicolines, Nearctic stagnicolines, Old World Radix and Pseudosuccinea allowed to conclude that (i) L. diaphana shows sequences very different from all other lymnaeids, (ii) each marker allows its differentiation, except cox1 amino acid sequence, and (iii) L. diaphana is not a fossarine lymnaeid, but rather an archaic relict form derived from the oldest North American stagnicoline ancestors. Phylogeny and large genetic distances support the genus Pectinidens as the first stagnicoline representative in the southern hemisphere, including colonization of extreme world regions, as most southern Patagonia, long time ago. The phylogenetic link of L. diaphana with the stagnicoline group may give light to the aforementioned peculiar low altitude epidemiological scenario of fascioliasis.

Human bocavirus 1 and 3 infection in children with acute gastroenteritis in Brazil

To determine the positivity rate of human bocavirus (HBoV) 1 and 3 among children who presented with acute gastroenteritis symptoms during the period of 1994-2004 in the Central-West Region of Brazil, 762 faecal samples were tested using polymerase chain reaction (PCR) for the detection of HBoV DNA. Primers for a segment of the non-structural viral protein 1 (NS1) gene of HBoV-1 and HBoV-3 were used. Twelve HBoV-positive samples were further characterised via genomic sequencing and phylogenetic analysis. Of the samples tested, 5.8% (n = 44) were positive for HBoV-1 or HBoV-3 and co-infection was observed in 14 (31.8%) of the 44 HBoV-positive samples. Nine of the 14 samples were also positive for Rotavirus A and five were positive for Aichi virus. The genomic sequencing of the NS1 partial sequence of 12 HBoV-samples showed that 11 samples were characterised as HBoV-1 and that one was characterised as HBoV-3. The phylogenetic analysis showed that the HBoV-1 samples had a high sequence homology to others previously identified in China, Sweden and Brazil. This is the first study conducted in the Central-West Region of Brazil to detect HBoV-1 and HBoV-3 in faecal samples from children with acute gastroenteritis. Further studies are required to define the role of HBoVs as aetiological agents of gastroenteritis.

Optimisation of an asymmetric polymerase chain reaction assay for the amplification of single-stranded DNA from Wuchereria bancrofti for electrochemical detection

Single-stranded DNA (ssDNA) is a prerequisite for electrochemical sensor-based detection of parasite DNA and other diagnostic applications. To achieve this detection, an asymmetric polymerase chain reaction method was optimised. This method facilitates amplification of ssDNA from the human lymphatic filarial parasite Wuchereria bancrofti. This procedure produced ssDNA fragments of 188 bp in a single step when primer pairs (forward and reverse) were used at a 100:1 molar ratio in the presence of double-stranded template DNA. The ssDNA thus produced was suitable for immobilisation as probe onto the surface of an Indium tin oxide electrode and hybridisation in a system for sequence-specific electrochemical detection of W. bancrofti. The hybridisation of the ssDNA probe and target ssDNA led to considerable decreases in both the anodic and the cathodic currents of the system's redox couple compared with the unhybridised DNA and could be detected via cyclic voltammetry. This method is reproducible and avoids many of the difficulties encountered by conventional methods of filarial parasite DNA detection; thus, it has potential in xenomonitoring.

A conventional polymerase chain reaction-based method for the diagnosis of human schistosomiasis in stool samples from individuals in a low-endemicity area

The aim of this study was to evaluate the efficacy of a polymerase chain reaction (PCR)-based method to detect Schistosoma mansoni DNA in stool samples from individuals living in a low-endemicity area in Brazil. Of the 125 initial stool samples, 80 were ELISA reactive and eggs were identified in 19 of the samples by parasitological examination. For the PCR evaluations, 56 stool samples were selected and divided into five groups. Groups I-IV were scored negative for S. mansoni eggs by parasitological examination. Groups I and II were ELISA reactive, whereas Groups III and IV were ELISA nonreactive. Groups II and III were positive for other intestinal parasites. PCR testing scored eight samples as positive from these four groups. Group V represented the S. mansoni -positive group and it included ELISA-reactive samples that were scored positive for S. mansoni by one or more parasitological examinations (6/19 were positive by Kato-Katz method, 9/17 by saline gradient and 10/13 by Helmintex®). PCR scored 13 of these 19 samples as positive for S. mansoni . We conclude that while none of these methods yielded 100% sensitivity, a combination of techniques should be effective for improving the detection of S. mansoni infection in low-endemicity areas.

Good agreements between self and clinician-collected specimens for the detection of human papillomavirus in Brazilian patients

Women infected with human papillomavirus (HPV) are at a higher risk of developing cervical lesions. In the current study, self and clinician-collected vaginal and cervical samples from women were processed to detect HPV DNA using polymerase chain reaction (PCR) with PGMY09/11 primers. HPV genotypes were determined using type-specific PCR. HPV DNA detection showed good concordance between self and clinician-collected samples (84.6%; kappa = 0.72). HPV infection was found in 30% women and genotyping was more concordant among high-risk HPV (HR-HPV) than low-risk HPV (HR-HPV). HPV16 was the most frequently detected among the HR-HPV types. LR-HPV was detected at a higher frequency in self-collected; however, HR-HPV types were more frequently identified in clinician-collected samples than in self-collected samples. HPV infections of multiple types were detected in 20.5% of clinician-collected samples and 15.5% of self-collected samples. In this study, we demonstrated that the HPV DNA detection rate in self-collected samples has good agreement with that of clinician-collected samples. Self-collected sampling, as a primary prevention strategy in countries with few resources, could be effective for identifying cases of HR-HPV, being more acceptable. The use of this method would enhance the coverage of screening programs for cervical cancer.

Exploring the environmental diversity of kinetoplastid flagellates in the high-throughput DNA sequencing era

The class Kinetoplastea encompasses both free-living and parasitic species from a wide range of hosts. Several representatives of this group are responsible for severe human diseases and for economic losses in agriculture and livestock. While this group encompasses over 30 genera, most of the available information has been derived from the vertebrate pathogenic genera Leishmaniaand Trypanosoma. Recent studies of the previously neglected groups of Kinetoplastea indicated that the actual diversity is much higher than previously thought. This article discusses the known segment of kinetoplastid diversity and how gene-directed Sanger sequencing and next-generation sequencing methods can help to deepen our knowledge of these interesting protists.

Association of human papillomavirus and Chlamydia trachomatis with intraepithelial alterations in cervix samples

The influence of different infectious agents and their association with human papillomavirus (HPV) in cervical carcinogenesis have not been completely elucidated. This study describes the association between cytological changes in cervical epithelium and the detection of the most relevant aetiological agents of sexually transmitted diseases. Samples collected from 169 patients were evaluated by conventional cytology followed by molecular analysis to detect HPV DNA, Chlamydia trachomatis, herpes simplex virus 1 and 2,Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, andTreponema pallidum, besides genotyping for most common high-risk HPV. An association between cytological lesions and different behavioural habits such as smoking and sedentariness was observed. Intraepithelial lesions were also associated with HPV and C. trachomatis detection. An association was also found between both simple and multiple genotype infection and cytological changes. The investigation of HPV and C. trachomatisproved its importance and may be considered in the future for including in screening programs, since these factors are linked to the early diagnosis of patients with precursor lesions of cervical cancer.

Bonafide, type-specific human papillomavirus persistence among HIV-positive pregnant women: predictive value for cytological abnormalities, a longitudinal cohort study

This study investigated the rate of human papillomavirus (HPV) persistence, associated risk factors, and predictors of cytological alteration outcomes in a cohort of human immunodeficiency virus-infected pregnant women over an 18-month period. HPV was typed through L1 gene sequencing in cervical smears collected during gestation and at 12 months after delivery. Outcomes were defined as nonpersistence (clearance of the HPV in the 2nd sample), re-infection (detection of different types of HPV in the 2 samples), and type-specific HPV persistence (the same HPV type found in both samples). An unfavourable cytological outcome was considered when the second exam showed progression to squamous intraepithelial lesion or high squamous intraepithelial lesion. Ninety patients were studied. HPV DNA persistence occurred in 50% of the cases composed of type-specific persistence (30%) or re-infection (20%). A low CD4+T-cell count at entry was a risk factor for type-specific, re-infection, or HPV DNA persistence. The odds ratio (OR) was almost three times higher in the type-specific group when compared with the re-infection group (OR = 2.8; 95% confidence interval: 0.43-22.79). Our findings show that bonafide (type-specific) HPV persistence is a stronger predictor for the development of cytological abnormalities, highlighting the need for HPV typing as opposed to HPV DNA testing in the clinical setting.

An in-house real-time polymerase chain reaction: standardisation and comparison with the Cobas Amplicor HBV monitor and Cobas AmpliPrep/Cobas TaqMan HBV tests for the quantification of hepatitis B virus DNA

This study aimed to standardise an in-house real-time polymerase chain reaction (rtPCR) to allow quantification of hepatitis B virus (HBV) DNA in serum or plasma samples, and to compare this method with two commercial assays, the Cobas Amplicor HBV monitor and the Cobas AmpliPrep/Cobas TaqMan HBV test. Samples from 397 patients from the state of São Paulo were analysed by all three methods. Fifty-two samples were from patients who were human immunodeficiency virus and hepatitis C virus positive, but HBV negative. Genotypes were characterised, and the viral load was measure in each sample. The in-house rtPCR showed an excellent success rate compared with commercial tests; inter-assay and intra-assay coefficients correlated with commercial tests (r = 0.96 and r = 0.913, p < 0.001) and the in-house test showed no genotype-dependent differences in detection and quantification rates. The in-house assay tested in this study could be used for screening and quantifying HBV DNA in order to monitor patients during therapy.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Lesões em DNA induzidas pela autoxidação de S(IV) na presença de íons metálicos de transição

The oxidation of sulfite catalyzed by transition metal ions produces reactive oxysulfur species that can damage plasmid and isolated DNA in vitro. Among the four DNA bases, guanine is the most sensitive to one-electron oxidation promoted by the species formed in the autoxidation of sulfite (HSO5-, HO•, SO3•-, SO4•- and SO5•-) due to its low reduction potential and ability to bind transition metal ions capable to catalyze oxidative processes. Some oxidative DNA lesions are promutagenic and oxidative DNA damage is proposed to play a crucial role in certain human pathologies, including cancer.

Comparison of Classical and Secondary Cytologic Criteria Relative to Hybrid Capture for Diagnosing Cervical-vaginal Infection by Human Papillomavirus

Objective To compare the diagnostic accuracy of the classic Meisels cytologic criteria and the Schneider secondary criteria relative to the hybrid capture method for diagnosing HPV infection. Methods This was a retrospective study performed at a public university hospital. A total of 41 patients with a cytologic diagnosis of HPV infection and 40 HPV-negative patients were selected for review of the cervical-vaginal smears seeking to classical and secondary criteria. A single pathologist reviewed the slides in search of the criteria. The classical and secondary cytologic criteria were compared with the hybrid capture for diagnosing HPV infection. Bartleti test was applied for the age analysis, and Fisher's exact test was used to compare proportions. The tests were considered significant when the probability of rejecting the null hypothesis was less than 5% (p < 0.05). Results The Meisels criteria were less sensitive (34.0%) than the secondary Schneider criteria (57.5%) when compared with the hybrid capture (p < 0.0001), although the specificity of the former criteria was non-significantly higher (91.2% and 67.7%, respectively). In cases of moderate or intense inflammation, the sensitivity and specificity of the Schneider criteria were decreased, 33.3% and 50.0% respectively (p = 0.0115). Conclusions Compared with hybrid capture for diagnosis of HPV infection, the sensitivity of the secondary Schneider criteria was higher than the classical Meisels criteria.Moderate or intense inflammation reduces the sensitivity and specificity of the secondary Schneider criteria for diagnosing HPV infection using the hybrid capture as the gold standard.

Clonal study of avian Escherichia coli strains by fliC conserved-DNA-sequence regions analysis

The clonal relationship among avian Escherichia coli strains and their genetic proximity with human pathogenic E. coli, Salmonela enterica, Yersinia enterocolitica and Proteus mirabilis, was determined by the DNA sequencing of the conserved 5' and 3'regions fliC gene (flagellin encoded gene). Among 30 commensal avian E. coli strains and 49 pathogenic avian E. coli strains (APEC), 24 commensal and 39 APEC strains harbored fliC gene with fragments size varying from 670bp to 1,900bp. The comparative analysis of these regions allowed the construction of a dendrogram of similarity possessing two main clusters: one compounded mainly by APEC strains and by H-antigens from human E. coli, and another one compounded by commensal avian E. coli strains, S. enterica, and by other H-antigens from human E. coli. Overall, this work demonstrated that fliC conserved regions may be associated with pathogenic clones of APEC strains, and also shows a great similarity among APEC and H-antigens of E. coli strains isolated from humans. These data, can add evidence that APEC strains can exhibit a zoonotic risk.

A 37-kb restriction map of the human immunoglobulin lambda variable locus, VB cluster, harboring four functional genes and two non-coding Vl sequences

The human immunoglobulin lambda variable locus (IGLV) is mapped at chromosome 22 band q11.1-q11.2. The 30 functional germline v-lambda genes sequenced untill now have been subgrouped into 10 families (Vl1 to Vl10). The number of Vl genes has been estimated at approximately 70. This locus is formed by three gene clusters (VA, VB and VC) that encompass the variable coding genes (V) responsible for the synthesis of lambda-type Ig light chains, and the Jl-Cl cluster with the joining segments and the constant genes. Recently the entire variable lambda gene locus was mapped by contig methodology and its one- megabase DNA totally sequenced. All the known functional V-lambda genes and pseudogenes were located. We screened a human genomic DNA cosmid library and isolated a clone with an insert of 37 kb (cosmid 8.3) encompassing four functional genes (IGLV7S1, IGLV1S1, IGLV1S2 and IGLV5a), a pseudogene (VlA) and a vestigial sequence (vg1) to study in detail the positions of the restriction sites surrounding the Vl genes. We generated a high resolution restriction map, locating 31 restriction sites in 37 kb of the VB cluster, a region rich in functional Vl genes. This mapping information opens the perspective for further RFLP studies and sequencing

Monitoring human cytomegalovirus viral load in peripheral blood leukocytes of renal transplant recipients by a simple limiting dilution-PCR assay

To assess the clinical relevance of a semi-quantitative measurement of human cytomegalovirus (HCMV) DNA in renal transplant recipients within the typical clinical context of a developing country where virtually 100% of both receptors and donors are seropositive for this virus, we have undertaken HCMV DNA quantification using a simple, semi-quantitative, limiting dilution polymerase chain reaction (PCR). We evaluated this assay prospectively in 52 renal transplant patients from whom a total of 495 serial blood samples were collected. The samples scored HCMV positive by qualitative PCR had the levels of HCMV DNA determined by end-point dilution-PCR. All patients were HCMV DNA positive during the monitoring period and a diagnosis of symptomatic infection was made for 4 of 52 patients. In symptomatic patients the geometric mean of the highest level of HCMV DNAemia was 152,000 copies per 106 leukocytes, while for the asymptomatic group this value was 12,050. Symptomatic patients showed high, protracted HCMV DNA levels, whereas asymptomatic patients demonstrated intermittent low or moderate levels. Using a cut-off value of 100,000 copies per 106 leukocytes, the limiting dilution assay had sensitivity of 100%, specificity of 92%, a positive predictive value of 43% and a negative predictive value of 100% for HCMV disease. In this patient group, there was universal HCMV infection but relatively infrequent symptomatic HCMV disease. The two patient groups were readily distinguished by monitoring with the limiting dilution assay, an extremely simple technology immediately applicable in any clinical laboratory with PCR capability.