Complete genome of the multidrug-resistant Acinetobacter baumannii strain KBN10P02143 isolated from Korea

Acinetobacter baumannii, a strictly aerobic, non-fermentative, Gram-negative coccobacillary rod-shaped bacterium, is an opportunistic pathogen in humans. We recently isolated a multidrug-resistant A. baumannii strain KBN10P02143 from the pus sample drawn from a surgical patient in South Korea. We report the complete genome of this strain, which consists of 4,139,396 bp (G + C content, 39.08%) with 3,868 protein-coding genes, 73 tRNAs and six rRNA operons. Identification of the genes related to multidrug resistance from this genome and the discovery of a novel conjugative plasmid will increase our understanding of the pathogenicity associated with this species.

Anopheles goeldii Rozeboom & Gabaldón (Diptera, Culicidae): a species of the Nuneztovari Complex of Anopheles Meigen

Anopheles (Nyssorhynchus) goeldiiRozeboom & Gabaldón, 1941, a species of the Nuneztovari Complex, was described based on morphological characteristics of the male, female, larva, pupa, and eggs. The type locality is Boa Vista (= Fordlândia), a district in the vicinity of Rio Tapajós, in the municipality of Aveiro, in the state of Pará, Brazil. Anopheles goeldii is redescribed based on morphological traits of the fourth instar larva, pupa, egg, and male and female. DNA sequences from the cytochrome oxidase subunit I (COI barcode region) of the mitochondrial genome were utilized for species characterization. Specimens of An. goeldii from the Pará, Amapá, and Amazonas states were employed to redescribe the species and to compare with morphologically similar taxa.

Crop sequences in no-tillage system: effects on soil fertility and soybean, maize and rice yield

Decomposing crop residues in no-tillage system can alter soil chemical properties, which may consequently influence the productivity of succession crops. The objective of this study was to evaluate soil chemical properties and soybean, maize and rice yield, grown in the summer, after winter crops in a no-tillage system. The experiment was carried out in Jaboticabal, SP, Brazil (21 ° 15 ' 22 '' S; 48 ° 18 ' 58 '' W) on a Red Latosol (Oxisol), in a completely randomized block design, in strip plots with three replications. The treatments consisted of four summer crop sequences (maize monocrop, soybean monocrop, soybean/maize rotation and rice/bean/cotton rotation) combined with seven winter crops (maize, sunflower, oilseed radish, pearl millet, pigeon pea, grain sorghum and sunn hemp). The experiment began in September 2002. After the winter crops in the 2005/2006 growing season and before the sowing of summer crops in the 2006/2007 season, soil samples were collected in the layers 0-2.5; 2.5-5.0; 5-10; 10-20; and 20-30 cm. Organic matter, pH, P, K+, Ca2+, Mg2+, and H + Al were determined in each soil sample. In the summer soybean/maize rotation and in maize the organic matter contents and P levels were lower, in the layers 0-10 cm and 0-20 cm, respectively. Summer rice/bean/cotton rotation increased soil K levels at 0-10 cm depth when sunn hemp and oilseed radish had previously been grown in the winter, and in the 0-2.5 cm layer for millet. Sunn hemp, millet, oilseed radish and sorghum grown in the winter increased organic matter contents in the soil down to 30 cm. Higher P levels were found at the depths 0-2.5 cm and 0-5 cm, respectively, when sunn hemp and oilseed radish were grown in the winter. Highest grain yields for soybean in monoculture were obtained in succession to winter oilseed radish and sunn hemp and in rotation with maize, after oilseed radish, sunn hemp and millet. Maize yields were highest in succession to winter oilseed radish, millet and pigeon pea. Rice yields were lowest when grown after sorghum.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Study of simple sequence repeat markers from coffee expressed sequences associated to leaf miner resistance

The objective of this work was to identify expressed simple sequence repeats (SSR) markers associated to leaf miner resistance in coffee progenies. Identification of SSR markers was accomplished by directed searches on the Brazilian Coffee Expressed Sequence Tags (EST) database. Sequence analysis of 32 selected SSR loci showed that 65% repeats are of tetra-, 21% of tri- and 14% of dinucleotides. Also, expressed SSR are localized frequently in the 5'-UTR of gene transcript. Moreover, most of the genes containing SSR are associated with defense mechanisms. Polymorphisms were analyzed in progenies segregating for resistance to the leaf miner and corresponding to advanced generations of a Coffea arabica x Coffea racemosa hybrid. Frequency of SSR alleles was 2.1 per locus. However, no polymorphism associated with leaf miner resistance was identified. These results suggest that marker-assisted selection in coffee breeding should be performed on the initial cross, in which genetic variability is still significant.

Amplification of 16S rRNA gene sequences to differentiate two highly related bradyrhizobia species

A 16S rRNA gene PCR-based assay was developed aiming at a fast molecular diagnostic method to differentiate the two phylogenetically closely related species Bradyrhizobium japonicum and B. elkanii, isolated from soybean nodules, in order to identify those more competitive and comprising greater nitrogen fixation ability for use in the formulation of commercial inoculants. The assay used was able to discriminate ten reference strains belonging to these two Bradyrhizobium species, as well as to efficiently identify 37 strains isolated from fields cultivated with soybean.