83 resultados para Vertical barrier
Resumo:
O presente estudo teve como objetivo caracterizar as alturas preferenciais de distribuição das bromélias em quatro estádios sucessionais (capoeirinha, capoeira, capoeirão e floresta secundária) em encostas da Ilha de Santa Catarina, relacionando-as com o desenvolvimento da floresta, com características individuais e dos forófitos. Foram calculados valores de importância das bromélias em cada estádio, relacionando-os aos tipos de diásporos e estratégias para obtenção de nutrientes. Cada um dos 60 forófitos determinados por estádio sucessional através de pontos quadrantes foi considerado uma unidade amostral e dividido em intervalos de altura de dois metros a partir do solo. As espécies do gênero Tillandsia com metabolismo CAM apresentaram os maiores valores de importância nos dois estádios mais avançados, onde houve ocorrência de bromélias. Em todos os estádios, na estratificação vertical, foi detectada uma tendência de maior riqueza e maior freqüência de bromélias em alturas próximas às médias dos pontos de inversão morfológica relacionado ao aumento de substrato disponível para fixação e crescimento. No capoeirão e na floresta secundária as plântulas cresceram em todos os intervalos de altura dos forófitos, indicando taxas de mortalidade diferentes quando considerada a distribuição dos indivíduos adultos. As mudanças nas condições microclimáticas dos progressivos estádios sucessionais provocaram deslocamentos de distribuição e trocas de espécies, com o aumento de indivíduos e de espécies formadoras de tanque.
Resumo:
Multiple episodes of blood-brain barrier disruption were induced by sequential intraspinal injections of ethidium bromide. In addition to the barrier disruption, there was toxic demyelination and exposure of myelin components to the immune system. Twenty-seven 3-month-old Wistar rats received 2, 3 or 4 injections of 1 µl of either 0.1% ethidium bromide in normal saline (19 rats) or 0.9% saline (8 rats) at different levels of the spinal cord. The time intervals between the injections ranged from 28 to 42 days. Ten days after the last injection, all rats were perfused with 2.5% glutaraldehyde. The spinal sections were evaluated macroscopically and by light and transmission electron microscopy. All the lesions demonstrated a mononuclear phagocytic infiltrate apparently removing myelin. Lymphocytes were not conspicuous and were found in only 34% of the lesions. No perivascular cuffings were detected. In older lesions (38 days and older) they were found only within Virchow-Robin spaces. This result suggests that multiple blood-brain barrier disruptions with demyelination and exposure of myelin components to the immune system were not sufficient to induce an immune-mediated reaction in the central nervous system.
Resumo:
Sentinel node (SN) status is the most important prognostic factor for localized melanoma. Usually, patients with Breslow thickness of less than 1.0 mm are not included in SN protocols. However, the literature presents a rate ranging from 3 to 7% of nodal recurrence in thin melanoma. Ulceration, regression and high mitotic rate have been considered to be indications for an SN biopsy. The metastatic potential of the vertical growth phase is uncertain. To correlate pathological features in thin melanoma with SN metastasis, we reviewed 358 patients submitted to SN biopsy. Seventy-seven patients with lesions of 1 mm or smaller were included in the study group. Histological evaluation of the primary tumor included thickness, Clark level, mitotic rate, ulceration, regression, and growth phase. Lymphoscintigraphy was performed on all patients. Lymphatic mapping and gamma probe detection were both used for SN biopsy. Histological examination of SN consisted of hematoxylin-eosin and immunohistochemical staining. Median follow-up was 37 months. Six patients had micrometastases. Statistical analysis by the Fisher test showed that ulceration (P = 0.019), high mitotic rate (P = 0.008) and vertical growth phase (P = 0.002) were positively correlated with micrometastases. If other studies confirm these results, more melanoma patients must be submitted to SN biopsy.
Resumo:
Little is known about the barrier properties of polymer films during high pressure processing of prepackaged foods. In order to learn more about this, we examined the influence of high hydrostatic pressure on the permeation of raspberry ketone (dissolved in ethanol/water) through polyamide-6 films at temperatures between 20 and 60ºC. Permeation was lowered by increasing pressure at all temperatures. At 23°C, the increasing pressure sequence 0.1, 50, 100, 150, and 200 MPa correlated with the decreasing permeation coefficients P/(10(9) cm² s-1) of 6.2, 3.8, 3.0, 2.2, and 1.6. Analysis of the permeation kinetics indicated that this effect was due to a reduced diffusion coefficient. Pressure and temperature acted antagonistically to each other. The decrease in permeation at 200 MPa was compensated for by a temperature increase of 20ºC. After release of pressure, the former permeation coefficients were recovered, which suggests that this `pressure effect' is reversible. Taken together, our data revealed no detrimental effects of high hydrostatic pressure on the barrier properties of polymer films.
Resumo:
The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.
Resumo:
The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
A presença marcante de uma prosa-poética na produção ficcional de Clarice Lispector possibilitou-nos exemplificar algumas noções centrais (tempo vertical e instante poético) na rica e sugestiva reflexão de Gaston Bachelard acerca do universo poético