98 resultados para Basophil Degranulation Test -- methods
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
The objectives of this work were to estimate the genetic and phenotypic parameters and to predict the genetic and genotypic values of the selection candidates obtained from intraspecific crosses in Panicum maximum as well as the performance of the hybrid progeny of the existing and projected crosses. Seventy-nine intraspecific hybrids obtained from artificial crosses among five apomictic and three sexual autotetraploid individuals were evaluated in a clonal test with two replications and ten plants per plot. Green matter yield, total and leaf dry matter yields and leaf percentage were evaluated in five cuts per year during three years. Genetic parameters were estimated and breeding and genotypic values were predicted using the restricted maximum likelihood/best linear unbiased prediction procedure (REML/BLUP). The dominant genetic variance was estimated by adjusting the effect of full-sib families. Low magnitude individual narrow sense heritabilities (0.02-0.05), individual broad sense heritabilities (0.14-0.20) and repeatability measured on an individual basis (0.15-0.21) were obtained. Dominance effects for all evaluated characteristics indicated that breeding strategies that explore heterosis must be adopted. Less than 5% increase in the parameter repeatability was obtained for a three-year evaluation period and may be the criterion to determine the maximum number of years of evaluation to be adopted, without compromising gain per cycle of selection. The identification of hybrid candidates for future cultivars and of those that can be incorporated into the breeding program was based on the genotypic and breeding values, respectively. The prediction of the performance of the hybrid progeny, based on the breeding values of the progenitors, permitted the identification of the best crosses and indicated the best parents to use in crosses.
Resumo:
The objective of this work was to determine how taxonomy benefited from the ecological quantitative and site-based sampling methods in enchytraeids studies. Enchytraeids (small relatives of earthworms) were sampled in different phases of rain forest regeneration in the southern Mata Atlântica in Paraná, Brazil. The research combined ecological and taxonomic work, because enchytraeids are poorly studied and difficult to identify, and many new species were expected. The provision of large numbers of specimens enabled the test of species diagnoses by investigating the ranges of character variations in a larger series of specimens. Simplified species diagnoses adapted to the local conditions that allowed the identification of all specimens, juveniles included, were developed. Key characters and character states are presented for the three genera: Achaeta, Hemienchytraeus and Guaranidrilus. Among several new species, a rare species, possibly a remnant of the autochthonous forest fauna, was found and described.
Resumo:
Objective: The present study was aimed at evaluating the viability of replacing 18F with 99mTc in dose calibrator linearity testing. Materials and Methods: The test was performed with sources of 99mTc (62 GBq) and 18F (12 GBq) whose activities were measured up to values lower than 1 MBq. Ratios and deviations between experimental and theoretical 99mTc and 18F sources activities were calculated and subsequently compared. Results: Mean deviations between experimental and theoretical 99mTc and 18F sources activities were 0.56 (± 1.79)% and 0.92 (± 1.19)%, respectively. The mean ratio between activities indicated by the device for the 99mTc source as measured with the equipment pre-calibrated to measure 99mTc and 18F was 3.42 (± 0.06), and for the 18F source this ratio was 3.39 (± 0.05), values considered constant over the measurement time. Conclusion: The results of the linearity test using 99mTc were compatible with those obtained with the 18F source, indicating the viability of utilizing both radioisotopes in dose calibrator linearity testing. Such information in association with the high potential of radiation exposure and costs involved in 18F acquisition suggest 99mTc as the element of choice to perform dose calibrator linearity tests in centers that use 18F, without any detriment to the procedure as well as to the quality of the nuclear medicine service.
Resumo:
Two high performance liquid chromatography (HPLC) methods for the quantitative determination of indinavir sulfate were tested, validated and statistically compared. Assays were carried out using as mobile phases mixtures of dibutylammonium phosphate buffer pH 6.5 and acetonitrile (55:45) at 1 mL/min or citrate buffer pH 5 and acetonitrile (60:40) at 1 mL/min, an octylsilane column (RP-8) and a UV spectrophotometric detector at 260 nm. Both methods showed good sensitivity, linearity, precision and accuracy. The statistical analysis using the t-student test for the determination of indinavir sulfate raw material and capsules indicated no statistically significant difference between the two methods.
Resumo:
This work describes the development and validation of a dissolution test for 50 mg losartan potassium capsules using HPLC and UV spectrophotometry. A 2(4) full factorial design was carried out to optimize dissolution conditions and potassium phosphate buffer, pH 6.8 as dissolution medium, basket as apparatus at the stirring speed of 50 rpm and time of 30 min were considered adequate. Both dissolution procedure and analytical methods were validated and a statistical analysis showed that there are no significant differences between HPLC and spectrophotometry. Since there is no official monograph, this dissolution test could be applied for quality control routine.
Resumo:
A dissolution test for in vitro evaluation of tablet dosage forms containing 10 mg of rupatadine was developed and validated by RP-LC. A discriminatory dissolution method was established using apparatus paddle at a stirring rate of 50 rpm with 900 mL of deaerated 0.01 M hydrochloric acid. The proposed method was validated yielding acceptable results for the parameters evaluated, and was applied for the quality control analysis of rupatadine tablets, and to evaluate the formulation during an accelerated stability study. Moreover, quantitative analyses were also performed, to compare the applicability of the RP-LC and the LC-MS/MS methods.
Resumo:
A simple, precise, specific, repeatable and discriminating dissolution test for primaquine (PQ) matrix tablets was developed and validated according to ICH and FDA guidelines. Two UV assaying methods were validated for determination of PQ released in 0.1 M hydrochloric acid and water media. Both methods were linear (R²>0.999), precise (R.S.D.<1.87%) and accurate (97.65-99.97%). Dissolution efficiency (69-88%) and equivalence of formulations (f2) was assessed in different media and apparatuses (basket/100 rpm and paddle/50 rpm) tested. Discriminating condition was 900 mL aqueous medium, basket at 100 rpm and sampling times at 1, 4 and 8 h. Repeatability (R.S.D.<2.71%) and intermediate precision (R.S.D.<2.06%) of dissolution method were satisfactory.
Resumo:
Three sensitive spectrophotometric methods are presented for the determination of finasteride in bulk and in tablets. The methods rely on the use of bromate-bromide reagent and three dyes namely, methyl orange, indigocarmine and thymol blue as reagents. They involve the addition of a measured excess of bromate-bromide reagent to finasteride in acid medium, and after the bromination reaction is judged to be complete, the unreacted bromine is determined by reacting with a fixed amount of either methylorange and measuring the absorbance at 520 nm (method A) or indigocarmine and measuring the absorbance at 610 nm (method B) or thymol blue and measuring the absorbance at 550 nm (method C). In all the methods, the amount of insitu generated bromine reacted corresponds to the amount of finasteride. The absorbance measured at the respective wavelength is found increase linearly with the concentration of finasteride. Beer's law is obeyed in the ranges 0.25- 2.0, 0.5-6.0 and 1-12 µg mL-1 for method A, method B and method C, respectively. The calculated molar absorptivity values are 5.7x10(4), 3.12x10(4) and 1.77x10(4) L mol-1 cm-1 respectively, for method A, method B and method C, and the corresponding Sandell sensitivity values are 0.0065, 0.012 and 0.021 µg cm-2. The limits of detection (LOD) and quantification (LOQ) are also reported for all the methods. Accuracy and, intra-day and inter-day precisions of the methods were established according to the current ICH guidelines. The methods were successfully applied to the determination of finasteride in commercially available tablets and the results were found to closely agree with the label claim. The results of the methods were statistically compared with those of a reference method by applying Student's t-test and F-test. The accuracy and reliability of the methods were further confirmed by performing recovery tests via standard addition procedure.
Resumo:
The rural electrification is characterized by geographical dispersion of the population, low consumption, high investment by consumers and high cost. Moreover, solar radiation constitutes an inexhaustible source of energy and in its conversion into electricity photovoltaic panels are used. In this study, equations were adjusted to field conditions presented by the manufacturer for current and power of small photovoltaic systems. The mathematical analysis was performed on the photovoltaic rural system I-100 from ISOFOTON, with power 300 Wp, located at the Experimental Farm Lageado of FCA/UNESP. For the development of such equations, the circuitry of photovoltaic cells has been studied to apply iterative numerical methods for the determination of electrical parameters and possible errors in the appropriate equations in the literature to reality. Therefore, a simulation of a photovoltaic panel was proposed through mathematical equations that were adjusted according to the data of local radiation. The results have presented equations that provide real answers to the user and may assist in the design of these systems, once calculated that the maximum power limit ensures a supply of energy generated. This real sizing helps establishing the possible applications of solar energy to the rural producer and informing the real possibilities of generating electricity from the sun.
Resumo:
The aim of this study was to compare two methods of tear sampling for protein quantification. Tear samples were collected from 29 healthy dogs (58 eyes) using Schirmer tear test (STT) strip and microcapillary tubes. The samples were frozen at -80ºC and analyzed by the Bradford method. Results were analyzed by Student's t test. The average protein concentration and standard deviation from tears collected with microcapillary tube were 4.45mg/mL ±0.35 and 4,52mg/mL ±0.29 for right and left eyes respectively. The average protein concentration and standard deviation from tears collected with Schirmer Tear Test (STT) strip were and 54.5mg/mL ±0.63 and 54.15mg/mL ±0.65 to right and left eyes respectively. Statistically significant differences (p<0.001) were found between the methods. In the conditions in which this study was conducted, the average protein concentration obtained with the Bradford test from tear samples obtained by Schirmer Tear Test (STT) strip showed values higher than those obtained with microcapillary tube. It is important that concentration of tear protein pattern values should be analyzed according the method used to collect tear samples.
Neuroethologic differences in sleep deprivation induced by the single- and multiple-platform methods
Resumo:
It has been proposed that the multiple-platform method (MP) for desynchronized sleep (DS) deprivation eliminates the stress induced by social isolation and by the restriction of locomotion in the single-platform (SP) method. MP, however, induces a higher increase in plasma corticosterone and ACTH levels than SP. Since deprivation is of heuristic value to identify the functional role of this state of sleep, the objective of the present study was to determine the behavioral differences exhibited by rats during sleep deprivation induced by these two methods. All behavioral patterns exhibited by a group of 7 albino male Wistar rats submitted to 4 days of sleep deprivation by the MP method (15 platforms, spaced 150 mm apart) and by 7 other rats submitted to sleep deprivation by the SP method were recorded in order to elaborate an ethogram. The behavioral patterns were quantitated in 10 replications by naive observers using other groups of 7 rats each submitted to the same deprivation schedule. Each quantification session lasted 35 min and the behavioral patterns presented by each rat over a period of 5 min were counted. The results obtained were: a) rats submitted to the MP method changed platforms at a mean rate of 2.62 ± 1.17 platforms h-1 animal-1; b) the number of episodes of noninteractive waking patterns for the MP animals was significantly higher than that for SP animals (1077 vs 768); c) additional episodes of waking patterns (26.9 ± 18.9 episodes/session) were promoted by social interaction in MP animals; d) the cumulative number of sleep episodes observed in the MP test (311) was significantly lower (chi-square test, 1 d.f., P<0.05) than that observed in the SP test (534); e) rats submitted to the MP test did not show the well-known increase in ambulatory activity observed after the end of the SP test; f) comparison of 6 MP and 6 SP rats showed a significantly shorter latency to the onset of DS in MP rats (7.8 ± 4.3 and 29.0 ± 25.0 min, respectively; Student t-test, P<0.05). We conclude that the social interaction occurring in the MP test generates additional stress since it increases the time of forced wakefulness and reduces the time of rest promoted by synchronized sleep.
Resumo:
Our aim was to compare the clinical features of panic disorder (PD) patients sensitive to hyperventilation or breath-holding methods of inducing panic attacks. Eighty-five PD patients were submitted to both a hyperventilation challenge test and a breath-holding test. They were asked to hyperventilate (30 breaths/min) for 4 min and a week later to hold their breath for as long as possible, four times with a 2-min interval. Anxiety scales were applied before and after the tests. We selected the patients who responded with a panic attack to just one of the tests, i.e., those who had a panic attack after hyperventilating (HPA, N = 24, 16 females, 8 males, mean age ± SD = 38.5 ± 12.7 years) and those who had a panic attack after breath holding (BHPA, N = 20, 11 females, 9 males, mean age ± SD = 42.1 ± 10.6 years). Both groups had similar (chi² = 1.28, d.f. = 1, P = 0.672) respiratory symptoms (fear of dying, chest/pain disconfort, shortness of breath, paresthesias, and feelings of choking) during a panic attack. The criteria of Briggs et al. [British Journal of Psychiatry, 1993; 163: 201-209] for respiratory PD subtype were fulfilled by 18 (75.0%) HPA patients and by 14 (70.0%) BHPA patients. The HPA group had a later onset of the disease compared to BHPA patients (37.9 ± 11.0 vs 21.3 ± 12.9 years old, Mann-Whitney, P < 0.001), and had a higher family prevalence of PD (70.8 vs 25.0%, chi² = 19.65, d.f. = 1, P = 0.041). Our data suggest that these two groups - HPA and BHPA patients - may be specific subtypes of PD.
Resumo:
The objective of the present investigation was to compare the sensitivity of an electronic nociceptive mechanical paw test with classical mechanical tests to quantify the intensity variation of inflammatory nociception. The electronic pressure-meter test consists of inducing the hindpaw flexion reflex by poking the plantar region with a polypropylene pipette tip adapted to a hand-held force transducer. This method was compared with the classical von Frey filaments test and with the rat paw constant pressure test, a modification of the Randall and Selitto test developed by our group. When comparing the three methods, the electronic pressure-meter and the rat paw constant pressure test, but not the von Frey filaments test, detected time vs treatment interactions in prostaglandin E2 (PGE2)-induced hypernociception. Both methods also detected the PGE2-induced hypernociception in dose- (50-400 ng/paw) and time- (1-4 h) dependent manners, and time vs treatment interactions induced by carrageenin (25-400 µg/paw). Furthermore, the electronic pressure-meter test was more sensitive at early times, whereas the constant pressure test was more sensitive at later times. Moreover, the electronic pressure-meter test detected the dose-dependent antinociceptive effect of local indomethacin (30-300 µg/paw) and dipyrone (80-320 µg/paw) on carrageenin- (200 µg/paw) and PGE2- (100 ng/paw) induced hypernociception, respectively, and also detected the ineffectiveness of indomethacin (300 µg) on the effect of PGE2. Our results show that the electronic pressure-meter provides a sensitive, objective and quantitative mechanical nociceptive test that could be useful to characterize new nociceptive inflammatory mediators and also to evaluate new peripheral analgesic substances.
Resumo:
Methods for reliable evaluation of spinal cord (SC) injury in rats at short periods (2 and 24 h) after lesion were tested to characterize the mechanisms implicated in primary SC damage. We measured the physiological changes occurring after several procedures for producing SC injury, with particular emphasis on sensorimotor functions. Segmental and suprasegmental reflexes were tested in 39 male Wistar rats weighing 250-300 g divided into three control groups that were subjected to a) anesthesia, b) dissection of soft prevertebral tissue, and c) laminectomy of the vertebral segments between T10 and L1. In the lesion group the SC was completely transected, hemisected or subjected to vertebral compression. All animals were evaluated 2 and 24 h after the experimental procedure by the hind limb motility index, Bohlman motor score, open-field, hot-plate, tail flick, and paw compression tests. The locomotion scale proved to be less sensitive than the sensorimotor tests. A reduction in exploratory movements was detected in the animals 24 h after the procedures. The hot-plate was the most sensitive test for detecting sensorimotor deficiencies following light, moderate or severe SC injury. The most sensitive and simplest test of reflex function was the hot-plate. The hemisection model promoted reproducible moderate SC injury which allowed us to quantify the resulting behavior and analyze the evolution of the lesion and its consequences during the first 24 h after injury. We conclude that hemisection permitted the quantitation of behavioral responses for evaluation of the development of deficits after lesions. Hind limb evaluation scores and spontaneous exploration events provided a sensitive index of immediate injury effects after SC lesion at 2 and 24 h. Taken together, locomotion scales, open-field, and hot-plate tests represent reproducible, quantitatively sensitive methods for detecting functional deficiencies within short periods of time, indicating their potential for the study of cellular mechanisms of primary injury and repair after traumatic SC injury.