89 resultados para 250603 Reaction Kinetics and Dynamics
Resumo:
Electrode kinetics and study of 'transition state' with applied potential in case of [M - antibiotics - cephalothin] system were reported at pH = 7.30 ± 0.01 at suitable supporting electrolyte at 25.0ºC. The M = Co or Ni and antibiotics were doxycycline, chlortetracycline, oxytetracycline, tetracycline, minocycline, amoxicillin and chloramphenicol used as primary ligands and cephalothin as secondary ligand. Kinetic parameters viz. transfer coefficient (a), degree of irreversibility (l), diffusion coefficient (D) and rate constant (k) were determined. The values of a and k varied from 0.41 to 0.59 and 2.60 X 10-3 cm s-1 to 9.67 X 10-3 cm s-1 in case of [Co - antibiotics - cephalothin] system. In case of [Ni - antibiotics - cephalothin], a and k varied from 0.41 to 0.58 and 2.34 X 10-3 cm s-1 to 9.19 X 10-3 cm s-1 respectively confirmed that transition state behaves between oxidant and reductant response to applied potential and it adjusts it self in such a way that the same is located midway between dropping mercury electrode and solution interface. The values of rate constant confirmed the quasireversible nature of electrode processes. The stability constants (logb) of complexes were also determined.
Resumo:
Leptospirosis is a worldwide anthropozoonosis that infects livestock, including sheep as the carriers to other animals and humans. The present study aimed to determine the prevalence of Leptospira spp. in sheep from two slaughterhouses in the state of São Paulo, Brazil and its association with epidemiological variables. Serum samples from 182 sheep were evaluated for Leptospira spp. antibodies by microscopic agglutination test (MAT). Results indicated 34/182 (18.68%; CI95% 13.70-24.98%) positive serum samples, mainly to the serovar Copenhageni (17/34; 50%; CI95% 33.99-66.01%). Bacterial growth in the Fletcher medium was detected for 13/34 (38.24%; CI95% 23.87-55.08%) animals, and confirmed by Polymerase Chain Reaction (PCR) and sequencing for only two kidney samples from two animals. Thus, treatment and vaccination of sheep, besides rodent control, can be useful to prevent the infection in the studied region since sheep are important Leptospira spp. carriers, and its transmission to slaughterhouse workers is mainly through the manipulation of visceral tissues.
Resumo:
The aim of this study was to investigate the occurrence of Toxoplasma gondii and compare the results obtained in the Modified Agglutination Test (MAT), Polimerase Chain Reaction (PCR) and bioassay in mice. In order to accomplish this, 40 free-range chickens from eight farms in neighboring areas to the Pantanal in Nhecolândia, Mato Grosso do Sul, were euthanized and blood samples, brain and heart were collected. The occurrence of anti-T. gondii antibodies found in chickens was 67.5% (27 samples), considering as a cutoff point the dilution 1:5. Among the samples analyzed, 7 (25.9%) were positive in the dilution 1:5, 3 (11.1%) in 1:10, 2 (7.4%) in 1:20, 3 (11.1%) in 1:320, 1 ( 3.7%) in 1:640, 3 (11.1%) in 1:1280, 2 (7.4%) in 1:2560, 4 (14.8%) in 1:5120 and 2 (7.4%) in 1:10.240. From the mixture of tissue samples (brain and heart) from the chickens analyzed, 16 (40%) presented electrophoretic bands compatible with T. gondii by PCR (gene B1). In the comparison of techniques, 59.26% positivity in PCR was revealed among animals that were seropositive in MAT (cutoff 1:5). From 141 inoculated mice, six (4.44%) died of acute toxoplasmosis between 15 and 23 days after inoculation. Surviving mice were sacrificed at 74 days after inoculation, and a total of 28 cysts were found in the brains of 10 distinct groups. From the seropositive hens, 27 bioassays were performed and 11 (40.7%) isolates were obtained. A greater number of isolations happened in mice that were inoculated with tissues from chickens that had high titers for anti-T. gondii antibodies. Chronic infection in mice was observed in nine groups (33.3%) from five different properties. Among the surviving mice, 25.6% were positive for T. gondii in MAT (1:25). From mice positive in PCR, 87.5% were also positive in MAT. Among the PCR-negative mice, 5.2% were positive for T. gondii in MAT. It can be concluded through this study that the occurrence of infecton by T. gondii in the rural properties studied was high, that PCR directed to gene B1 does not confirm the viability of the parasite, but it can be used as a screening method for the selection of chickens infected by T. gondii, that the animals with titer greater than 10 must be prioritized for the selection of animals for bioassay, since for them, the chances of isolating the parasite are greater and that seroconversion in experimentally infected mice is not a good indicator for isolating the agent.
Resumo:
Magellanic penguins (Spheniscus magellanicus) routinely migrate from their breeding colonies to Southern Brazil often contracting diseases during this migration, notably avian malaria, which has been already reported in Brazil and throughout the world. Detection of Plasmodium spp. in blood smears is the routine diagnostic method of avian malaria, however it has a low sensitivity rate when compared to molecular methods. Considering the negative impact of avian malaria on penguins, the aim of this study was to detect the presence of Plasmodium spp. in Magellanic penguins using Polymerase Chain Reaction (PCR) and by verifying clinical, hematological, and biochemical alterations in blood samples as well as to verify the likely prognosis in response to infection. Blood samples were obtained from 75 penguins to determine packed cell volume (PCV), red blood cell (RBC) and white blood cell (WBC) counts, mean corpuscular volume (MCV), uric acid, total protein, albumin, globulin and aspartate aminotransferase (AST) activity levels. Whole blood samples were used for PCR assays. Plasmodium spp. was detected in 32.0% of the specimens using PCR and in 29.3% using microscopic analyses. Anorexia, diarrhea and neurological disorders were more frequent in penguins with malaria and a significant weight difference between infected and non-infected penguins was detected. PCV and MCV rates showed no significant difference. RBC and WBC counts were lower in animals with avian malaria and leukopenia was present in some penguins. Basophil and lymphocyte counts were lower in infected penguins along with high monocyte counts. There was no significant difference in AST activities between infected and non-infected animals. There was a significant increase in uric acid values, however a decrease in albumin values was observed in infected penguins. Based on this study, we concluded that Plasmodium spp. occurs in Magellanic penguins of rehabilitation centers in Southeastern Brazil, compromising the weight of infected animals with clinical alterations appearing in severe cases of this disease. It was also noted that, although the hematological abnormalities presented by these animals may not have been conclusive, leukopenia, monocytosis and the decrease of basophils and lymphocytes revealed an unfavorable prognosis, and Plasmodium spp. infections may progress with elevated uric acid concentration and low albumin levels.
Resumo:
The intensive use of pesticides have contaminated the soil and groundwater. The application of herbicides as controlled release formulations may reduce the environmental damage related to their use because it may optimize the efficiency of the active ingredient and reducing thus the recommended dose. The objective of this study was to evaluate the persistence of the herbicide atrazine applied as commercial formulation (COM) and as controlled release formulation (xerogel - XER) in Oxisol. The experimental design used was split-plot randomized-blocks with four replications, in a (2 x 6) + 1 arrangement. The two formulations (COM and XER) were assigned to main plots and different atrazine concentrations (0, 3.200, 3.600, 4.200, 5.400 and 8.000 g atrazine ha-1) were assigned to sub-plots. Persistence was determined by means of dissipation kinetics and bioavailability tests. The methodology of bioassays to assess the atrazine availability is efficient and enables to distinguish the tested formulations. The availability of atrazine XER is higher than the commercial in two different periods: up to 5 days after herbicide application and at the 35th day after application. The XER formulation tends to be more persistent in relation to COM formulation.
Resumo:
Two variants (A and B) of the widely employed Walker 256 rat tumor cells are known. When inoculated sc, the A variant produces solid, invasive, highly metastasizing tumors that cause severe systemic effects and death. We have obtained a regressive variant (AR) whose sc growth is slower, resulting in 70-80% regression followed by development of immunity against A and AR variants. Simultaneously with the beginning of tumor regression, a temporary anemia developed (~8 days duration), accompanied by marked splenomegaly (~300%) and changes in red blood cell osmotic fragility, with mean corpuscular fragility increasing from 4.1 to 6.5 g/l NaCl. The possibility was raised that plasma factors associated with the immune response induced these changes. In the present study, we identify and compare the osmotic fragility increasing activity of plasma fractions obtained from A and AR tumor bearers at different stages of tumor development. The results showed that by day 4 compounds precipitating in 60% (NH4)2SO4 and able to increase red blood cell osmotic fragility appeared in the plasma of A and AR tumor bearers. Later, these compounds disappeared from the plasma of A tumor bearers but slightly increased in the plasma of AR tumor bearers. Furthermore, by day 10, compounds precipitating between 60 and 80% (NH4)2SO4 and with similar effects appeared only in plasma of AR tumor bearers. The salt solubility, production kinetics and hemolytic activity of these compounds resemble those of the immunoglobulins. This, together with their preferential increase in rats bearing the AR variant, suggest their association with an immune response against this tumor.
Resumo:
Using a short-term bulk culture protocol designed for an intracellular-staining method based on a flow cytometry approach to the frequencies of cytokine-producing cells from tuberculosis and leprosy patients, we found distinct patterns of T cell subset expression. The method also reveals the profile of peak cytokine production and can provide simultaneous information about the phenotype of cytokine-producing cells, providing a reliable assay for monitoring the immunity of these patients. The immune response of Mycobacterium leprae and purified protein derivative (PPD) in vitro to a panel of mycobacteria-infected patients from an endemic area was assessed in primary mononuclear cell cultures. The kinetics and source of the cytokine pattern were measured at the single-cell level. IFN-gamma-, TNF-alpha-, IL-4- and IL-10-secreting T cells were intracytoplasmic evaluated in an attempt to identify M. leprae- and PPD-specific cells directly from the peripheral blood. The analysis by this approach indicated that TNF-alpha was the first (8 h) to be produced, followed by IFN-gamma (16 h), IL-10 (20 h) and IL-4 (24 h), and double-staining experiments confirmed that CD4+ were a greater source of TNF-alpha than of CD8+ T cells (P < 0.05). Both T cell subsets secreted similar amounts of IFN-gamma. We conclude that the protocol permits rapid evaluation of cytokine production by different T cell populations. The method can also be used to define immune status in non-infected and contact individuals.
Resumo:
We have shown that the free cholesterol (FC) and the cholesteryl ester (CE) moieties of a nanoemulsion with lipidic structure resembling low-density lipoproteins show distinct metabolic fate in subjects and that this may be related to the presence of dyslipidemia and atherosclerosis. The question was raised whether induction of hyperlipidemia and atherosclerosis in rabbits would affect the metabolic behavior of the two cholesterol forms. Male New Zealand rabbits aged 4-5 months were allocated to a control group (N = 17) fed regular chow and to a 1% cholesterol-fed group (N = 13) during a 2-month period. Subsequently, the nanoemulsion labeled with ³H-FC and 14C-CE was injected intravenously for the determination of plasma kinetics and tissue uptake of the radioactive labels. In controls, FC and CE had similar plasma kinetics (fractional clearance rate, FCR = 0.234 ± 0.056 and 0.170 ± 0.038 h-1, respectively; P = 0.065). In cholesterol-fed rabbits, the clearance of both labels was delayed and, as a remarkable feature, FC-FCR (0.089 ± 0.033 h-1) was considerably greater than CE-FCR (0.046 ± 0.010 h-1; P = 0.026). In the liver, the major nanoemulsion uptake site, uptake of the labels was similar in control animals (FC = 0.2256 ± 0.1475 and CE = 0.2135 ± 0.1580%/g) but in cholesterol-fed animals FC uptake (0.0890 ± 0.0319%/g) was greater than CE uptake (0.0595 ± 0.0207%/g; P < 0.05). Therefore, whereas in controls, FC and CE have similar metabolism, the induction of dyslipidemia and atherosclerosis resulted in dissociation of the two forms of cholesterol.
Resumo:
Round holes in the ears of MRL mice tend to close with characteristics of regeneration believed to be absent in other mouse strains (e.g., C57BL/6). We evaluated the kinetics and the histopathology of ear wound closure in young (8 weeks old) C57BL/6 and BALB/c mice. We also used middle-aged (40 weeks old) C57BL/6 mice to evaluate the influence of aging on this process. A circular through-and-through hole was made in the ear, photographs were taken at different times after injury and wound area was measured with digital analysis software. The percentages of closed area measured on day 100 were: 23.57 ± 8.66% for young BALB/c mice, 56.47 ± 7.39% for young C57BL/6 mice, and 75.31 ± 23.65% for middle-aged C57BL/6 mice. Mice were sacrificed on days 1, 3, 5, 25, 44, and 100 for histological evaluation with hematoxylin and eosin, Gomori’s trichrome, periodic acid-Schiff, or picrosirius red staining. In young mice of both strains, healing included re-epithelialization, chondrogenesis, myogenesis, and collagen deposition. Young C57BL/6 and BALB/c mice differed in the organization of collagen fibers visualized using picrosirius-polarization. Sebaceous glands and hair follicles regenerated and chondrogenesis was greater in young C57BL/6 mice. In middle-aged C57BL/6 mice all aspects of regeneration were depressed. The characteristics of regeneration were present during ear wound healing in both young BALB/c and young C57BL/6 mice although they differed in intensity and pattern. Greater ear wound closure in middle-aged C57BL/6 mice was not correlated with regeneration.
Resumo:
Bovine herpesvirus type 5 (BoHV-5) is an important pathogen of cattle in South America. We describe here the construction and characterization of deletion mutants defective in the glycoprotein E (gE) or thymidine kinase (TK) gene or both (gE/TK) from a highly neurovirulent and well-characterized Brazilian BoHV-5 strain (SV507/99). A gE-deleted recombinant virus (BoHV-5 gE∆) was first generated in which the entire gE open reading frame was replaced with a chimeric green fluorescent protein gene. A TK-deleted recombinant virus (BoHV-5 TK∆) was then generated in which most of the TK open reading frame sequences were deleted and replaced with a chimeric β-galactosidase gene. Subsequently, using the BoHV-5 gE∆ virus as backbone, a double gene-deleted (TK plus gE) BoHV-5 recombinant (BoHV-5 gE/TK∆) was generated. The deletion of the gE and TK genes was confirmed by immunoblotting and PCR, respectively. In Madin Darby bovine kidney (MDBK) cells, the mutants lacking gE (BoHV-5 gE∆) and TK + gE (BoHV-5 gE/TK∆) produced small plaques while the TK-deleted BoHV-5 produced wild-type-sized plaques. The growth kinetics and virus yields in MDBK cells for all three recombinants (BoHV-5 gE∆, BoHV-5 TK∆ and BoHV-5 gE/TK∆) were similar to those of the parental virus. It is our belief that the dual gene-deleted recombinant (BoHV-5 gE/TK∆) produced on the background of a highly neurovirulent Brazilian BoHV-5 strain may have potential application in a vaccine against BoHV-5.
Resumo:
The objectives of this study were to determine if protein-energy malnutrition (PEM) could affect the hematologic response to lipopolysaccharide (LPS), the interleukin-1β (IL-1β) production, leukocyte migration, and blood leukocyte expression of CD11a/CD18. Two-month-old male Swiss mice were submitted to PEM (N = 30) with a low-protein diet (14 days) containing 4% protein, compared to 20% protein in the control group (N = 30). The total cellularity of blood, bone marrow, spleen, and bronchoalveolar lavage evaluated after the LPS stimulus indicated reduced number of total cells in all compartments studied and different kinetics of migration in malnourished animals. The in vitro migration assay showed reduced capacity of migration after the LPS stimulus in malnourished animals (45.7 ± 17.2 x 10(4) cells/mL) compared to control (69.6 ± 7.1 x 10(4) cells/mL, P ≤ 0.05), but there was no difference in CD11a/CD18 expression on the surface of blood leukocytes. In addition, the production of IL-1β in vivo after the LPS stimulus (180.7 pg·h-1·mL-1), and in vitro by bone marrow and spleen cells (41.6 ± 15.0 and 8.3 ± 4.0 pg/mL) was significantly lower in malnourished animals compared to control (591.1 pg·h-1·mL-1, 67.0 ± 23.0 and 17.5 ± 8.0 pg/mL, respectively, P ≤ 0.05). The reduced expression of IL-1β, together with the lower number of leukocytes in the central and peripheral compartments, different leukocyte kinetics, and reduced leukocyte migration capacity are factors that interfere with the capacity to mount an adequate immune response, being partly responsible for the immunodeficiency observed in PEM.
Resumo:
The immunostimulatory properties of inactivated Parapoxvirus ovis (iPPVO) have long been investigated in different animal species and experimental settings. In this study, we investigated the effects of iPPVO on cytokine expression in mice after intraperitoneal inoculation. Spleen and sera collected from iPPVO-treated mice at intervals after inoculation were submitted to cytokine mRNA determination by real-time PCR (qPCR), serum protein concentration by ELISA, and interferon (IFN)-α/β activity by bioassay. The spleen of iPPVO-treated animals showed a significant increase in mRNA expression of all cytokines assayed, with different kinetics and magnitude. Proinflammatory cytokines interleukin (IL)-1β, tumor necrosis factor-alpha (TNF-α), and IL-8 mRNA peaked at 24 hours postinoculation (hpi; 5.4-fold increase) and 48 hpi (3- and 10-fold increases), respectively. A 15-fold increase in IFN-γ and 6-fold IL-12 mRNA increase were detected at 48 and 24 hpi, respectively. Increased expression of autoregulatory cytokines (Th2), mainly IL-10 and IL-4, could be detected at later times (72 and 96 hpi) with peaks of 4.7- and 4.9-fold increases, respectively. IFN-I antiviral activity against encephalomyocarditis virus was demonstrated in sera of treated animals between 6 and 12 hpi, with a >90% reduction in the number of plaques. Measurement of serum proteins by ELISA revealed increased levels of IL-1, TNF-α, IL-12, IFN-γ, and IL-10, with kinetics similar to those observed by qPCR, especially for IL-12 and IFN-γ. These data demonstrate that iPPVO induced a transient and complex cytokine response, initially represented by Th1-related cytokines followed by autoregulatory and Th2 cytokines.
Resumo:
Associations between polymorphisms of the CD36 gene and susceptibility to coronary artery heart disease (CHD) are not clear. We assessed allele frequencies and genotype distributions of CD36 gene polymorphisms in 112 CHD patients and 129 control patients using semi-quantitative polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis. Additionally, we detected CD36 mRNA expression by real-time quantitative PCR, and we quantified plasma levels of oxidized low-density lipoprotein (ox-LDL) using an enzyme-linked immunosorbent assay (ELISA). There were no significant differences between the two groups (P>0.05) in allele frequencies of rs1761667 or in genotype distribution and allele frequencies of rs3173798. The genotype distribution of rs1761667 significantly differed between CHD patients and controls (P=0.034), with a significantly higher frequency of the AG genotype in the CHD group compared to the control group (P=0.011). The plasma levels of ox-LDL in patients with the AG genotype were remarkably higher than those with the GG and AA genotypes (P=0.010). In a randomized sample taken from patients in the two groups, the CD36 mRNA expression of the CHD patients was higher than that of the controls. In CHD patients, the CD36 mRNA expression in AG genotype patients was remarkably higher than in those with an AA genotype (P=0.005). After adjusted logistic regression analysis, the AG genotype of rs1761667 was associated with an increased risk of CHD (OR=2.337, 95% CI=1.336-4.087, P=0.003). In conclusion, the rs1761667 polymorphism may be closely associated with developing CHD in the Chongqing Han population of China, and an AG genotype may be a genetic susceptibility factor for CHD.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.