Chronic carriers of hepatitis B surface antigen in an endemic area for schistosomiasis mansoni in Brazil

Data on the association of schistosomiasis and hepatitis B in field-based studies are scarce. Two areas have been selected for this study: i) Queixadinha, endemic for schistosomiasis, with a population of 693 individuals, and ii) Capão, a control non-endemic area, with 515 inhabitants. Sera of all individuals in both areas were tested for hepatitis B infection, yearly, from 1994 to 1997. In the first area hepatitis B was found in 32.1% of children up to one year old and reached a peak of 68.7% in the age range of 15 to 19 years. In the control area the prevalence of hepatitis B was under 5% up to 19 years of age and the highest prevalence was observed in adults over 45. HBsAg was detected in 9.4% of the individuals living in the endemic area for schistosomiasis and in 1.4% of the controls (OR=4.98; 95%CI=3.7-6.7). The index of chronicity of HBsAg was not statistically different in the studied areas (8.1% x 7.3%; OR = 1.09; 95%CI= 0.42-3.03), nor was it different for people with and without schistosomiasis in Queixadinha (8.7% x 7.0%). We conclude that the Schistosoma mansoni infection has not altered the course of hepatitis B in the studied area.

Laboratory and Field Evaluation of Biodegradable Polyesters for Sustained Release of Isometamidium and Ethidium

An overview is presented of the results obtained with biodegradable sustained release devices (SRDs) containing a mixture of polymers and either isometamidium (ISMM) or ethidium. Under controlled laboratory conditions (monthly challenge with tsetse flies infected with Trypanosoma congolense) the protection period in SRD treated cattle could be extended by a factor 2.8 (for ethidium) up to 4.2 (for ISMM) as compared to animals treated intramuscularly with the same drugs. Using a competitive drug ELISA ISMM concentrations were detected up to 330 days after the implantation of the SRDs, whereas after i.m. injection the drug was no longer present three to four months post treatment. Two field trials carried out in Mali under heavy tsetse challenge showed that the cumulative infection rate was significantly lower in the ISMM-SRD implanted cattle than in those which received ISMM intramuscularly. Using ethidium SRD, however, contradictory results were obtained in field trials in Zambia and in Mali. The potential advantages and inconvenients of the use of SRDs are discussed and suggestions are made in order to further improve the currently available devices.

A Heminested Polymerase Chain Reaction for the Detection of Brazilian Rabies Isolates from Vampire Bats and Herbivores

A heminested-PCR (hn-PCR) using primers to the nucleoprotein-coding gene in a nested set was evaluated in the detection of Brazilian strains of rabies virus (RV). A representative number of RV nucleoprotein sequences belonging to genotype 1 were aligned. Based on such alignment, primers were directed to highly conserved regions. All 42 clinical samples positive by both fluorescent antibody and mouse inoculation tests were also positive by the hn-PCR. Brain tissue that had been left to decompose, obtained from an experimentally inoculated mouse was tested by hn-PCR and yielded positive results. In conclusion, primers designed here were capable of amplifying Brazilian RV isolates obtained from a rural epidemiological cycle.

Schistosomiasis mansoni in areas of low transmission: epidemiological characterization of Venezuelan foci

Severe schistosomiasis is a rare event in Venezuela nowadays, after a successful national campaign by the Schistosomiasis Control Program. Unfortunately, this program has practically disappeared, and snail surveillance in field is not a priority, anymore. Thus, schistosomiasis has become a neglected disease in this country. However, surveys in different populations from the endemic area have shown particular epidemiological features described herein. In five communities we evaluated 2,175 persons and searched for the presence of Biomphalaria glabrata snails. Some markers were used for classifying schistosomiasis foci: mean age of the persons with Schistosoma mansoni eggs in the stools, serological tests, presence of B. glabrata snails, and intensity of infection. Places without B. glabrata snails and with few schistosomiasis cases were defined as "past transmission sites"; a site with abundant snails but few cases was defined as "potential risk"; "new transmission" foci were characterized by the presence of infected snails and young people passing eggs in the stools. A "re-emergent" focus has shared these last features, showing in addition a place where schistosomiasis had been reported before. Recent evidences of active transmission with the increasing dispersion of B. glabrata snails, point out the necessity for the re-establishment of the Schistosomiasis Control Program in Venezuela.

Role of enhanced detoxication in a deltamethrin-resistant population of Triatoma infestans (Hemiptera, Reduviidae) from Argentina

Deltamethrin and other pyrethroids have been extensively used in Argentina since 1980, for the chemical control of Triatoma infestans Klug (Hemiptera: Reduviidae). Recently, resistance to deltamethrin was detected in field populations by the survival of bugs exposed by topical application to the diagnostic dose estimated on the CIPEIN susceptible strain. Results of the current study showed low resistant ratios (RRs) to deltamethrin for the resistant populations (RR ranged from 2.0 for San Luis colony to 7.9 for Salta colony). Biochemical studies were made on the most resistant colony (Salta) and the susceptible strain (CIPEIN), in order to establish the importance of degradative mechanisms as a cause of the detected resistance. Esterase activity was measured on 3 days old first instars through phenylthioacetate and a-naphtyl acetate activities. The results showed a significant difference in no cholinesterase esterase activity from susceptible (7.6 ± 0,7 µM S./i.min.) and Salta resistant colony (9.5 ± 0.8 µM S./i.min.). Cytochrome P450 mono-oxygenase (P450) activity was measured on individual insects through ethoxycoumarine deethylase (ECOD) activity using a fluorescence micro plate reader. The dependence of ECOD activity on age and body region of the nymphs, and pH and time of incubation were studied in order to optimize the measurement. As a result, comparative studies were performed on abdomens of 2 days old first instars at pH 7.2 and 4 h incubation time. ECOD activity of first nymphs was significantly lower in the susceptible colony (61.3 ± 9.08 pg ECOD/ insect) than in the resistant one (108.1± 5.7 pg ECOD/ insect). These results suggest that degradative esterases (no-cholinesterase) and mono-oxygenases cytochrome P450, play an important role in the resistance to deltamethrin in Salta colony from Argentina.

Laboratory and field evaluation of the effects of the neonicotinoid imidacloprid on the oviposition response of Aedes (Stegomyia) aegypti Linnaeus (Diptera: Culicidae)

In this paper, we assessed the suitability of using the neonicotinoid imidacloprid with standard ovitraps by evaluating the ovicidal properties of imidacloprid and its influence on the oviposition response of gravid females of Aedes (Stegomyia) aegypti Linnaeus (Diptera: Culicidae). First, we calculated the imidacloprid lethal dose 99 (LD99) by exposing third instar larvae of the target species to different concentrations of the insecticide. Next, Ae. aegypti eggs were exposed to the imidacloprid LD99 for 24 h and hatching inhibition was recorded. Finally, we investigated any potential repellent effect of the imidacloprid solution on the oviposition response of gravid Aedes females in field and laboratory conditions. The LD99 obtained from larvae tests proved to be sufficient to keep any exposed eggs from hatching. No repellent effect was observed; females laid as many eggs in imidacloprid-treated ovitraps as in traps containing either clean water or temephos-treated water in both field and laboratory conditions. Our results indicate that imidacloprid is a suitable insecticide for treating ovitraps against Ae. aegypti.

Genetic polymorphism in Taenia solium metacestodes from different Brazilian geographic areas

The aim of the present study is to investigate genetic polymorphisms in Taenia solium metacestodes from different Brazilian geographical areas and to relate them to antibody recognition in serum samples of neurocysticercosis (NC) patients. Metacestodes were obtained from the Distrito Federal (DF), Bahia, Minas Gerais (MG) and São Paulo (SP) regions of Brazil. Samples of human sera from 49 individuals with NC, 68 individuals with other helminthiasis and 40 healthy volunteers were analysed (157 individuals in total). Antigens were prepared and used in enzyme-linked immunosorbent assay and western blotting assays to detect specific immunoglobulin G antibodies. Genetic distances between metacestode populations were analysed using random amplified polymorphic DNA (RAPD) analysis. Our results show that there was a higher frequency of reactivity in the DF region in the sera from NC patients (p < 0.05), while discrimination between active and inactive NC was seen only in extracts from the MG and SP regions (p < 0.05). Using RAPD, the sample from the DF region presented a greater increase compared to the other regions. A relationship between genetic polymorphisms among T. solium metacestodes from different areas in Brazil and the differences in antibody detection in patients with NC were established.

An evaluation of the dot-ELISA procedure as a diagnostic test in an area with a high prevalence of human Toxocara canis infection

The aim of this work was to evaluate a dot-enzyme-linked immunosorbent assay (dot-ELISA) using excretory-secretory antigens from the larval stages of Toxocara canis for the diagnosis of toxocariasis. A secondary aim was to establish the optimal conditions for its use in an area with a high prevalence of human T. canis infection. The dot-ELISA test was standardised using different concentrations of the antigen fixed on nitrocellulose paper strips and increasing dilutions of the serum and conjugate. Both the dot-ELISA and standard ELISA methods were tested in parallel with the same batch of sera from controls and from individuals living in the problem area. The best results were obtained with 1.33 µg/mL of antigen, dilutions of 1/80 for the samples and controls and a dilution of 1/5,000 for the anti-human IgG-peroxidase conjugate. All steps of the procedure were performed at room temperature. The coincidence between ELISA and dot-ELISA was 85% and the kappa index was 0.72. The dot-ELISA test described here is rapid, easy to perform and does not require expensive equipment. Thus, this test is suitable for the serological diagnosis of human T. canis infection in field surveys and in the primary health care centres of endemic regions.

New sonographic measures of peripheral nerves: a tool for the diagnosis of peripheral nerve involvement in leprosy

To evaluate ultrasonographic (US) cross-sectional areas (CSAs) of peripheral nerves, indexes of the differences between CSAs at the same point (∆CSAs) and between tunnel (T) and pre-tunnel (PT) ulnar CSAs (∆TPTs) in leprosy patients (LPs) and healthy volunteers (HVs). Seventy-seven LPs and 49 HVs underwent bilateral US at PT and T ulnar points, as well as along the median (M) and common fibular (CF) nerves, to calculate the CSAs, ∆CSAs and ∆TPTs. The CSA values in HVs were lower than those in LPs (p < 0.0001) at the PT (5.67/9.78 mm2) and T (6.50/10.94 mm2) points, as well as at the M (5.85/8.48 mm2) and CF (8.17/14.14 mm2) nerves. The optimum CSA- receiver operating characteristic (ROC) points and sensitivities/specificities were, respectively, 6.85 mm2 and 68-85% for the PT point, 7.35 mm2 and 71-78% for the T point, 6.75 mm2 and 62-75% for the M nerve and 9.55 mm2 and 81-72% for the CF nerve. The ∆CSAs of the LPs were greater than those of the HVs at the PT point (4.02/0.85; p = 0.007), T point (3.71/0.98; p = 0.0005) and CF nerve (2.93/1.14; p = 0.015), with no difference found for the M nerve (1.41/0.95; p = 0.17). The optimum ∆CSA-ROC points, sensitivities, specificities and p-values were, respectively, 1.35, 49%, 80% and 0.003 at the PT point, 1.55, 55-85% and 0.0006 at the T point, 0.70, 58-50% and 0.73 for the M nerve and 1.25, 54-67% and 0.022 for the CF nerve. The ∆TPT in the LPs was greater than that in the HVs (4.43/1.44; p <0.0001). The optimum ∆TPT-ROC point was 2.65 (90% sensitivity/41% specificity, p < 0.0001). The ROC analysis of CSAs showed the highest specificity and sensitivity at the PT point and CF nerve, respectively. The PT and T ∆CSAs had high specificities (> 80%) and ∆TPT had the highest specificity (> 90%). New sonographic peripheral nerve measurements (∆CSAs and ∆TPT) provide an important methodological improvement in the detection of leprosy neuropathy.

Evaluation of the WHO classification of dengue disease severity during an epidemic in 2011 in the state of Ceará, Brazil

In 2009, the World Health Organization (WHO) issued a new guideline that stratifies dengue-affected patients into severe (SD) and non-severe dengue (NSD) (with or without warning signs). To evaluate the new recommendations, we completed a retrospective cross-sectional study of the dengue haemorrhagic fever (DHF) cases reported during an outbreak in 2011 in northeastern Brazil. We investigated 84 suspected DHF patients, including 45 (53.6%) males and 39 (46.4%) females. The ages of the patients ranged from five-83 years and the median age was 29. According to the DHF/dengue shock syndrome classification, 53 (63.1%) patients were classified as having dengue fever and 31 (36.9%) as having DHF. According to the 2009 WHO classification, 32 (38.1%) patients were grouped as having NSD [4 (4.8%) without warning signs and 28 (33.3%) with warning signs] and 52 (61.9%) as having SD. A better performance of the revised classification in the detection of severe clinical manifestations allows for an improved detection of patients with SD and may reduce deaths. The revised classification will not only facilitate effective screening and patient management, but will also enable the collection of standardised surveillance data for future epidemiological and clinical studies.

A morphological reappraisal of the immature stages and life history of Elachista synethes Meyrick (Lepidoptera, Elachistidae), an Australian leaf miner alien to Chile

ABSTRACT Elachista synethes was recently recognized as an alien species in northern Chile, where its larvae mine the rescue grass Bromus catharticus (Poaceae). In order to provide the necessary information to allow field detection of E. synethes during early ontogeny, we conducted a morphological reappraisal of the immature stages of this leaf-miner moth, based on light and scanning electron microscopy, including the first descriptions of the egg and the first-instar larva. This is the first report of the existence of an apodal early larva for a species of Elachista Treitschke. The legs and prolegs are absent in the first two instars, but are well developed in the last two. Additional observations on the life history are also provided, including a description of the mine.

Spore communities of arbuscular mycorrhizal fungi and mycorrhizal associations in different ecosystems, south Australia

Communities of arbuscular mycorrhizal fungi (AMF) were surveyed in different South Australian ecosystems. The soil was wet-sieved for spore extraction, followed by the determination of presence and abundance of AMF species as well as the percentage of root colonization. Mycorrhizal associations were common and there was substantial fungal diversity in different ecosystems. Spores were most abundant in the permanent pasture system and less abundant under continuous wheat. The incidence of mycorrhizal associations in different plant species and the occurrence of Arum and Paris type colonization generally conformed with previous information. Spores of seventeen AMF were verified throughout seasonal changes in 1996 and 1997 in the permanent pasture and on four host species (Lolium perenne, Plantago lanceolata, Sorghum sp. and Trifolium subterraneum) , set up with the same soils under greenhouse conditions. Glomus mosseae was the dominant spore type at all sampling times and in all trap cultures. Mycorrhizal diversity was significantly affected by different sampling times in trap cultures but not in field-collected soil. P. lanceolata, Sorghum sp. and T. subterraneum as hosts for trap cultures showed no differences in richness and diversity of AMF spores that developed in association with their roots. Abundance and diversity were lowest, however, in association with L. perenne , particularly in December 1996. Results show that the combination of spore identification from field-collected soil and trap cultures is essential to study population and diversity of AMF. The study provides baseline data for ongoing monitoring of mycorrhizal populations using conventional methods and material for the determination of the symbiotic effectiveness of AMF key members.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Use of solaria to predict weed density and floristic composition in no-till cropping systems

The objective of this work was to evaluate the efficiency of a new method, developed for predicting density and floristic composition of weed communities in field crops. Based on the use of solaria (100 mm transparent plastic tarps lying on the soil) to stimulate weed seedlings emergence, the method was tested in Tandil, Argentina, from 1998 to 2001. The system involved corn and sunflower in commercial no-till system. Major weeds in the experiments included Digitaria sanguinalis, Setaria verticillata and S. viridis, which accounted for 98% of the weed community in the three years of experiments since 1998. Large numbers of Tagetes minuta, Chenopodium album and Ammi majus were present in 2001. Comparison of weed communities under solaria with communities in field crops indicated that the method is useful for predicting the presence and density of some major weed species, at both high and low densities, of individuals in areas of 10 ha using only five solaria. Low density of weed species makes the method particularly useful to help deciding the time for herbicide applications to avoid soil contamination.

Leaf plasticity in successive selection cycles of 'Saracura' maize in response to periodic soil flooding

The objective of this work was to assess the effect of successive selection cycles on leaf plasticity of 'Saracura' maize BRS-4154 under periodical flooding in field conditions. Soil flooding started at the six-leaf stage with the application of a 20-cm depth water layer three times a week. At flowering, samples of leaves were collected and fixed. Paradermic and transverse sections were observed under photonic microscope. Several changes were observed throughout the selection cycles, such as modifications in the number and size of the stomata, higher amount of vascular bundles and the resulting decrease of the distance between them, smaller diameter of the metaxylem, decrease of cuticle and epidermis thickness, decrease of number and size of bulliform cells, increase of phloem thickness, smaller sclerenchyma area. Therefore, the successive selection cycles of 'Saracura' maize resulted in changes in the leaf anatomy, which might be favorable to the plant's tolerance to the intermittent flooding of the soil.