Biological evaluation of recombinant human erythropoietin in pharmaceutical products

The potencies of mammalian cell-derived recombinant human erythropoietin pharmaceutical preparations, from a total of five manufacturers, were assessed by in vivo bioassay using standardized protocols. Eight-week-old normocythemic mice received a single subcutaneous injection followed by blood sampling 96 h later or multiple daily injections with blood sampling 24 h after the last injection. Reticulocyte counting by microscopic examination was employed as the end-point using the brilliant cresyl blue or selective hemolysis methods, together with automated flow cytometry. Different injection schedules were investigated and dose-response curves for the European Pharmacopoeia Biological Reference Preparation of erythropoietin were compared. Manual and automated methods of reticulocyte counting were correlated with respect to assay validity and precision. Using 8 mice per treatment group, intra-assay precision determined for all of the assays in the study showed coefficients of variation of 12.1-28.4% for the brilliant cresyl blue method, 14.1-30.8% for the selective hemolysis method and 8.5-19.7% for the flow cytometry method. Applying the single injection protocol, a combination of at least two independent assays was required to achieve the precision potency and confidence limits indicated by the manufacturers, while the multiple daily injection protocol yielded the same acceptable results within a single assay. Although the latter protocol using flow cytometry for reticulocyte counting gave more precise and reproducible results (intra-assay coefficients of variation: 5.9-14.2%), the well-characterized manual methods provide equally valid alternatives for the quality control of recombinant human erythropoietin therapeutic products.

Rarity of DNA sequence alterations in the promoter region of the human androgen receptor gene

The human androgen receptor (AR) gene promoter lies in a GC-rich region containing two principal sites of transcription initiation and a putative Sp1 protein-binding site, without typical "TATA" and "CAAT" boxes. It has been suggested that mutations within the 5'untranslated region (5'UTR) may contribute to the development of prostate cancer by changing the rates of gene transcription and/or translation. In order to investigate this question, the aim of the present study was to search for the presence of mutations or polymorphisms at the AR-5'UTR in 92 prostate cancer patients, where histological diagnosis of adenocarcinoma was established in specimens obtained from transurethral resection or after prostatectomy. The AR-5'UTR was amplified by PCR from genomic DNA samples of the patients and of 100 healthy male blood donors, included as controls. Conformation-sensitive gel electrophoresis was used for DNA sequence alteration screening. Only one band shift was detected in one individual from the blood donor group. Sequencing revealed a new single nucleotide deletion (T) in the most conserved portion of the promoter region at position +36 downstream from the transcription initiation site I. Although the effect of this specific mutation remains unknown, its rarity reveals the high degree of sequence conservation of the human androgen promoter region. Moreover, the absence of detectable variation within the critical 5'UTR in prostate cancer patients indicates a low probability of its involvement in prostate cancer etiology.

Dexamethasone blocks the migration of the human neuroblastoma cell line SK-N-SH

Glucocorticoids (Gc) influence the differentiation of neural crest-derived cells such as those composing sympathoadrenal tumors like pheochromocytomas, as well as neuroblastomas and gangliomas. In order to obtain further information on the effects of Gc on cells evolving from the neural crest, we have used the human neuroblastoma cell line SK-N-SH to analyze: 1) the presence and the binding characteristics of Gc receptors in these cells, 2) the effect of dexamethasone (Dex) on the migration of SK-N-SH cells, and 3) the effect of Dex on the organization of the cytoskeleton of SK-N-SH cells. We show that: 1) receptors that bind [³H]-Dex with high affinity and high capacity (Kd of 9.6 nM, Bmax of 47 fmol/mg cytosolic protein, corresponding to 28,303 sites/cell) are present in cytosolic preparations of SK-N-SH cells, and 2) treatment with Dex (in the range of 10 nM to 1 µM) has an inhibitory effect (from 100% to 74 and 43%, respectively) on the chemotaxis of SK-N-SH cells elicited by fetal bovine serum. This inhibition is completely reversed by the Gc receptor antagonist RU486 (1 µM), and 3) as demonstrated by fluorescent phalloidin-actin detection, the effect of Dex (100 nM) on SK-N-SH cell migration is accompanied by modifications of the cytoskeleton organization that appear with stress fibers. These modifications did not take place in the presence of 1 µM RU486. The present data demonstrate for the first time that Dex affects the migration of neuroblastoma cells as well as their cytoskeleton organization by interacting with specific receptors. These findings provide new insights on the mechanism(s) of action of Gc on cells originating in the neural crest.

Beneficial effect of recombinant human growth hormone on the intestinal mucosa barrier of septic rats

The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.

Distribution of the human leukocyte antigen class II alleles in Brazilian patients with chronic hepatitis C virus infection

Hepatitis C virus (HCV) infection is a global medical problem. The current standard of treatment consists of the combination of peginterferon plus ribavirin. This regimen eradicates HCV in 55% of cases. The immune response to HCV is an important determinant of disease evolution and can be influenced by various host factors. HLA class II may play an important role in immune response against HCV. The objective of the present study was to determine the distribution of HLA class II (DRB1 and DQB1) alleles, their association with chronic HCV infection and their response to interferon therapy. One hundred and two unrelated white Brazilian patients with chronic HCV infection, 52 responders (45 males and 7 females) and 50 non-responders (43 males and 7 females) to antiviral treatment, were included in the study. Healthy Brazilian bone marrow donors of Caucasian origin from the same geographic area constituted the control group (HLA-DRB1, N = 99 and HLA-DQB1, N = 222 individuals). HLA class II genotyping was performed using a low-resolution DRB1, DQB1 sequence-specific primer amplification. There were higher frequencies of HLA-DRB1*13 (26.5 vs 14.1%) and HLA-DQB1*02 (52.9 vs 38.7%) in patients compared with controls; however, these were not significantly different after P correction (Pc = 0.39 and Pc = 0.082, respectively). There was no significant difference between the phenotypic frequencies of HLA-DRB1 (17.3 vs 14.0%) and HLA-DQB1 alleles in responder and non-responder HCV patients. The HLA-DRB1*07 allele was significantly more common in HCV patients (33.3 vs 12.1%) than in controls (Pc = 0.0039), suggesting that the HLA-DRB1*07 allele is associated with chronic HCV infection.

Effect of the human leukocyte antigen HLA-DRB1 and anti-cyclic citrullinated peptide on the outcome of rheumatoid arthritis patients

Our objective was to determine whether the presence of the human leukocyte antigen HLA-DRB1 locus is associated with production of anti-cyclic citrullinated peptide antibodies (anti-CCP Abs) and to what extent they are associated with increased susceptibility to and severity of rheumatoid arthritis (RA) in Egyptian patients. Twenty-nine RA patients gave informed consent to participate in a case-control study that was approved by the Ain Shams University Medical Ethics Committee. RA disease activity and severity were determined using the simplified disease activity index and Larsen scores, respectively. We used a wide scale national study on the pattern of HLA typing in normal Egyptians as a control study. Anti-CCP Abs and HLA-DRB1 typing were determined for all subjects. The alleles most strongly associated with RA were HLA-DRB1 [*01 , *04 and *06] (41.4%). RA patients with serum anti-CCP Ab titers above 60 U/mL had a significantly higher frequency of HLA-DRB1*01 (58.3%) and HLA-DRB1*04 alleles (83.3%). Significant positive correlations were found between serum and synovial anti-CCP Ab titer, RA disease activity, and severity (r = 0.87, 0.66 and 0.63, respectively; P < 0.05). HLA-DRB1 SE+ alleles [*01 and *04] were highly expressed among Egyptian RA patients. The presence of these alleles was associated with higher anti-CCP Ab titer, active and severe RA disease. Early determination of HLA-DRB1 SE+ alleles and serum anti-CCP Ab could facilitate the prediction of the clinical course and prognosis of RA when first evaluated leading to better disease control.

Enhanced inhibition of murine prostatic carcinoma growth by immunization with or administration of viable human umbilical vein endothelial cells and CRM197

Vaccination with xenogeneic and syngeneic endothelial cells is effective for inhibiting tumor growth. Nontoxic diphtheria toxin (CRM197), as an immunogen or as a specific inhibitor of heparin-binding EGF-like growth factor, has shown promising antitumor activity. Therefore, immunization with or administration of viable human umbilical vein endothelial cells (HUVECs) combined with CRM197 could have an enhanced antitumor effect. Six-week-old C57BL/6J male mice were vaccinated with viable HUVECs, 1 x 10(6) viable HUVECs combined with 100 μg CRM197, or 100 μg CRM197 alone by ip injections once a week for 4 consecutive weeks. RM-1 cells (5 x 10(5)) were inoculated by sc injection as a preventive procedure. During the therapeutic procedure, 6-week-old male C57BL/6J mice were challenged with 1 x 10(5) RM-1 cells, then injected sc with 1 x 10(6) viable HUVECs, 1 x 10(6) viable HUVECs + 100 μg CRM197, and 100 μg CRM197 alone twice a week for 4 consecutive weeks. Tumor volume and life span were monitored. We also investigated the effects of immunization with HUVECs on the aortic arch wall and on wound healing. Vaccination with or administration of viable HUVECs+CRM197 enhanced the inhibition of RM-1 prostatic carcinoma by 24 and 29%, respectively, and prolonged the life span for 3 and 4 days, respectively, compared with those of only vaccination or administration with viable HUVECs of tumor-bearing C57BL/6J mice. Furthermore, HUVEC immunization caused some damage to the aortic arch wall but did not have remarkable effects on the rate of wound healing; the wounds healed in approximately 13 days. Treatment with CRM197 in combination with viable HUVECs resulted in a marked enhancement of the antitumor effect in the preventive or therapeutic treatment for prostatic carcinoma in vivo, suggesting a novel combination for anti-cancer therapy.

RNAi-mediated knockdown of pituitary tumor- transforming gene-1 (PTTG1) suppresses the proliferation and invasive potential of PC3 human prostate cancer cells

Pituitary tumor-transforming gene-1 (PTTG1) is a proto-oncogene that promotes tumorigenesis and metastasis in numerous cell types and is overexpressed in a variety of human tumors. We have demonstrated that PTTG1 expression was up-regulated in both human prostate cancer specimens and prostate cancer cell lines. For a more direct assessment of the function of PTTG1 in prostate tumorigenesis, RNAi-mediated knockdown was used to selectively decrease PTTG1 expression in PC3 human prostate tumor cells. After three weeks of selection, colonies stably transfected with PTTG1-targeted RNAi (the knockdown PC3 cell line) or empty vector (the control PC3 cell line) were selected and expanded to investigate the role of PTTG1 expression in PC3 cell growth and invasion. Cell proliferation rate was significantly slower (28%) in the PTTG1 knockdown line after 6 days of growth as indicated by an MTT cell viability assay (P < 0.05). Similarly, a soft agar colony formation assay revealed significantly fewer (66.7%) PTTG1 knockdown PC3 cell colonies than control colonies after three weeks of growth. In addition, PTTG1 knockdown resulted in cell cycle arrest at G1 as indicated by fluorescence-activated cell sorting. The PTTG1 knockdown PC3 cell line also exhibited significantly reduced migration through Matrigel in a transwell assay of invasive potential, and down-regulation of PTTG1 could lead to increased sensitivity of these prostate cancer cells to a commonly used anticancer drug, taxol. Thus, PTTG1 expression is crucial for PC3 cell proliferation and invasion, and could be a promising new target for prostate cancer therapy.

Challenges in the research and development of new human vaccines

The field of vaccinology was born from the observations by the fathers of vaccination, Edward Jenner and Louis Pasteur, that a permanent, positive change in the way our bodies respond to life-threatening infectious diseases can be obtained by specific challenge with the inactivated infectious agent performed in a controlled manner, avoiding the development of clinical disease upon exposure to the virulent pathogen. Many of the vaccines still in use today were developed on an empirical basis, essentially following the paradigm established by Pasteur, “isolate, inactivate, and inject” the disease-causing microorganism, and are capable of eliciting uniform, long-term immune memory responses that constitute the key to their proven efficacy. However, vaccines for pathogens considered as priority targets of public health concern are still lacking. The literature tends to focus more often on vaccine research problems associated with specific pathogens, but it is increasingly clear that there are common bottlenecks in vaccine research, which need to be solved in order to advance the development of the field as a whole. As part of a group of articles, the objective of the present report is to pinpoint these bottlenecks, exploring the literature for common problems and solutions in vaccine research applied to different situations. Our goal is to stimulate brainstorming among specialists of different fields related to vaccine research and development. Here, we briefly summarize the topics we intend to deal with in this discussion.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

CTLA4 enhances the osteogenic differentiation of allogeneic human mesenchymal stem cells in a model of immune activation

Allogeneic mesenchymal stem cells (allo-MSCs) have recently garnered increasing interest for their broad clinical therapy applications. Despite this, many studies have shown that allo-MSCs are associated with a high rate of graft rejection unless immunosuppressive therapy is administered to control allo-immune responses. Cytotoxic T-lymphocyte-associated protein 4 (CTLA4) is a co-inhibitory molecule expressed on T cells that mediates the inhibition of T-cell function. Here, we investigated the osteogenic differentiation potency of allo-MSCs in an activated immune system that mimics the in vivo allo-MSC grafting microenvironment and explored the immunomodulatory role of the helper T cell receptorCTLA4 in this process. We found that MSC osteogenic differentiation was inhibited in the presence of the activated immune response and that overexpression of CTLA4 in allo-MSCs suppressed the immune response and promoted osteogenic differentiation. Our results support the application of CTLA4-overexpressing allo-MSCs in bone tissue engineering.

Has social justice any legitimacy in Kant's theory of right? The empirical conditions of the legal state as a civil union

This paper aims at shedding light on an obscure point in Kant's theory of the state. It discusses whether Kant's rational theory of the state recognises the fact that certain exceptional social situations, such as the extreme poverty of some parts of the population, could request institutional state support in order to guarantee the attainment of a minimum threshold of civil independence. It has three aims: 1) to show that Kant's Doctrine of Right can offer solutions for the complex relation between economics and politics in our present time; 2) to demonstrate the claim that Kant embraces a pragmatic standpoint when he tackles the social concerns of the state, and so to refute the idea that he argues for an abstract conception of politics; and 3) to suggest that a non-paternalistic theory of rights is not necessarily incompatible with the basic tenets of a welfare state.