Inactivated Parapoxvirus ovis induces a transient increase in the expression of proinflammatory, Th1-related, and autoregulatory cytokines in mice

The immunostimulatory properties of inactivated Parapoxvirus ovis (iPPVO) have long been investigated in different animal species and experimental settings. In this study, we investigated the effects of iPPVO on cytokine expression in mice after intraperitoneal inoculation. Spleen and sera collected from iPPVO-treated mice at intervals after inoculation were submitted to cytokine mRNA determination by real-time PCR (qPCR), serum protein concentration by ELISA, and interferon (IFN)-α/β activity by bioassay. The spleen of iPPVO-treated animals showed a significant increase in mRNA expression of all cytokines assayed, with different kinetics and magnitude. Proinflammatory cytokines interleukin (IL)-1β, tumor necrosis factor-alpha (TNF-α), and IL-8 mRNA peaked at 24 hours postinoculation (hpi; 5.4-fold increase) and 48 hpi (3- and 10-fold increases), respectively. A 15-fold increase in IFN-γ and 6-fold IL-12 mRNA increase were detected at 48 and 24 hpi, respectively. Increased expression of autoregulatory cytokines (Th2), mainly IL-10 and IL-4, could be detected at later times (72 and 96 hpi) with peaks of 4.7- and 4.9-fold increases, respectively. IFN-I antiviral activity against encephalomyocarditis virus was demonstrated in sera of treated animals between 6 and 12 hpi, with a >90% reduction in the number of plaques. Measurement of serum proteins by ELISA revealed increased levels of IL-1, TNF-α, IL-12, IFN-γ, and IL-10, with kinetics similar to those observed by qPCR, especially for IL-12 and IFN-γ. These data demonstrate that iPPVO induced a transient and complex cytokine response, initially represented by Th1-related cytokines followed by autoregulatory and Th2 cytokines.

Association among genetic predisposition, gut microbiota, and host immune response in the etiopathogenesis of inflammatory bowel disease

Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), is a chronic disorder that affects thousands of people around the world. These diseases are characterized by exacerbated uncontrolled intestinal inflammation that leads to poor quality of life in affected patients. Although the exact cause of IBD still remains unknown, compelling evidence suggests that the interplay among immune deregulation, environmental factors, and genetic polymorphisms contributes to the multifactorial nature of the disease. Therefore, in this review we present classical and novel findings regarding IBD etiopathogenesis. Considering the genetic causes of the diseases, alterations in about 100 genes or allelic variants, most of them in components of the immune system, have been related to IBD susceptibility. Dysbiosis of the intestinal microbiota also plays a role in the initiation or perpetuation of gut inflammation, which develops under altered or impaired immune responses. In this context, unbalanced innate and especially adaptive immunity has been considered one of the major contributing factors to IBD development, with the involvement of the Th1, Th2, and Th17 effector population in addition to impaired regulatory responses in CD or UC. Finally, an understanding of the interplay among pathogenic triggers of IBD will improve knowledge about the immunological mechanisms of gut inflammation, thus providing novel tools for IBD control.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Follicular helper T cell in immunity and autoimmunity

The traditional concept that effector T helper (Th) responses are mediated by Th1/Th2 cell subtypes has been broadened by the recent demonstration of two new effector T helper cells, the IL-17 producing cells (Th17) and the follicular helper T cells (Tfh). These new subsets have many features in common, such as the ability to produce IL-21 and to express the IL-23 receptor (IL23R), the inducible co-stimulatory molecule ICOS, and the transcription factor c-Maf, all of them essential for expansion and establishment of the final pool of both subsets. Tfh cells differ from Th17 by their ability to home to B cell areas in secondary lymphoid tissue through interactions mediated by the chemokine receptor CXCR5 and its ligand CXCL13. These CXCR5+ CD4+ T cells are considered an effector T cell type specialized in B cell help, with a transcriptional profile distinct from Th1 and Th2 cells. The role of Tfh cells and its primary product, IL-21, on B-cell activation and differentiation is essential for humoral immunity against infectious agents. However, when deregulated, Tfh cells could represent an important mechanism contributing to exacerbated humoral response and autoantibody production in autoimmune diseases. This review highlights the importance of Tfh cells by focusing on their biology and differentiation processes in the context of normal immune response to infectious microorganisms and their role in the pathogenesis of autoimmune diseases.