Application of the differential display RT-PCR strategy for the identification of inflammation-related mouse genes

The inflammatory response elicited by various stimuli such as microbial products or cytokines is determined by differences in the pattern of cellular gene expression. We have used the differential display RT-PCR (DDRT-PCR) strategy to identify mRNAs that are differentially expressed in various murine cell types stimulated with pro-inflammatory cytokines, microbial products or anti-inflammatory drugs. Mouse embryonic fibroblasts (MEFs) were treated with IFNs, TNF, or sodium salicylate. Also, peritoneal macrophages from C3H/Hej mice were stimulated with T. cruzi-derived GPI-mucin and/or IFN-g. After DDRT-PCR, various cDNA fragments that were differentially represented on the sequencing gel were recovered, cloned and sequenced. Here, we describe a summary of several experiments and show that, when 16 of a total of 28 recovered fragments were tested for differential expression, 5 (31%) were found to represent mRNAs whose steady-state levels are indeed modulated by the original stimuli. Some of the identified cDNAs encode for known proteins that were not previously associated with the inflammatory process triggered by the original stimuli. Other cDNA fragments (8 of 21 sequences, or 38%) showed no significant homology with known sequences and represent new mouse genes whose characterization might contribute to our understanding of inflammation. In conclusion, DDRT-PCR has proven to be a potent technology that will allow us to identify genes that are differentially expressed when cells are subjected to changes in culture conditions or isolated from different organs.

A simple RT-PCR-based strategy for screening connexin identity

Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx) proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s) can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain) that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

Comparison of the quantitative competitive and semiquantitative RT-PCR methods for the determination of interferon-gamma mRNA levels in AIDS-free HIV-infected individuals

IFN-gamma mRNA expression was evaluated in nonstimulated peripheral blood mononuclear cells (PBMC) of HIV-infected and seronegative individuals using quantitative competitive and semiquantitative RT-PCR and the sensitivity of these methods was compared. A significant correlation was found between quantitative competitive and semiquantitative RT-PCR in samples of both HIV-seronegative (P = 0.004) and HIV-infected individuals (P = 0.0004). PBMC from HIV-infected individuals presented a remarkable increase of IFN-gamma mRNA expression, as determined by both types of RT-PCR methods. Semiquantitative RT-PCR even without an internal standard is also acceptable for measuring cytokine mRNA expression, but less reliable if small amounts are quantified. Moreover, we found that increased IFN-gammamRNA expression is independent of CD4+ cell count in AIDS-free HIV-infected patients.

Evaluation of stunned and infarcted canine myocardium by real time myocardial contrast echocardiography

Differentiation between stunned and infarcted myocardium in the setting of acute ischemia is challenging. Real time myocardial contrast echocardiography allows the simultaneous assessment of myocardial perfusion and function. In the present study we evaluated infarcted and stunned myocardium in an experimental model using real time myocardial contrast echocardiography. Sixteen dogs underwent 180 min of coronary occlusion followed by reperfusion (infarct model) and seven other dogs were submitted to 20 min of coronary occlusion followed by reperfusion (stunned model). Wall motion abnormality and perfusional myocardial defect areas were measured by planimetry. Risk and infarct areas were determined by tissue staining. In the infarct model, the wall motion abnormality area during coronary occlusion (5.52 ± 1.14 cm²) was larger than the perfusional myocardial defect area (3.71 ± 1.45 cm²; P < 0.001). Reperfusion resulted in maintenance of wall motion abnormality (5.45 ± 1.41 cm²; P = 0.43 versus occlusion) and reduction of perfusional myocardial defect (1.51 ± 1.29 cm²; P = 0.004 versus occlusion). Infarct size determined by contrast echocardiography correlated with tissue staining (r = 0.71; P = 0.002). In the stunned model, the wall motion abnormality area was 5.49 ± 0.68 cm² during occlusion and remained 5.1 ± 0.63 cm² after reperfusion (P = 0.07). Perfusional defect area was 2.43 ± 0.79 cm² during occlusion and was reduced to 0.2 ± 0.53 cm² after reperfusion (P = 0.04). 2,3,5-Triphenyl tetrazolium chloride staining confirmed the absence of necrotic myocardium in all dogs in the stunned model. Real time myocardial contrast echocardiography is a noninvasive technique capable of distinguishing between stunned and infarcted myocardium after acute ischemia.

Standard-curve competitive RT-PCR quantification of myogenic regulatory factors in chicken embryos

The reverse transcription-polymerase chain reaction (RT-PCR) is the most sensitive method used to evaluate gene expression. Although many advances have been made since quantitative RT-PCR was first described, few reports deal with the mathematical bases of this technique. The aim of the present study was to develop and standardize a competitive PCR method using standard-curves to quantify transcripts of the myogenic regulatory factors MyoD, Myf-5, Myogenin and MRF4 in chicken embryos. Competitor cDNA molecules were constructed for each gene under study using deletion primers, which were designed to maintain the anchorage sites for the primers used to amplify target cDNAs. Standard-curves were prepared by co-amplification of different amounts of target cDNA with a constant amount of competitor. The content of specific mRNAs in embryo cDNAs was determined after PCR with a known amount of competitor and comparison to standard-curves. Transcripts of the housekeeping ß-actin gene were measured to normalize the results. As predicted by the model, most of the standard-curves showed a slope close to 1, while intercepts varied depending on the relative efficiency of competitor amplification. The sensitivity of the RT-PCR method permitted the detection of as few as 60 MyoD/Myf-5 molecules per reaction but approximately 600 molecules of MRF4/Myogenin mRNAS were necessary to produce a measurable signal. A coefficient of variation of 6 to 19% was estimated for the different genes analyzed (6 to 9 repetitions). The competitive RT-PCR assay described here is sensitive, precise and allows quantification of up to 9 transcripts from a single cDNA sample.

Bioeffects of albumin-encapsulated microbubbles and real-time myocardial contrast echocardiography in an experimental canine model

Myocardial contrast echocardiography has been used for assessing myocardial perfusion. Some concerns regarding its safety still remain, mainly regarding the induction of microvascular alterations. We sought to determine the bioeffects of microbubbles and real-time myocardial contrast echocardiography (RTMCE) in a closed-chest canine model. Eighteen mongrel dogs were randomly assigned to two groups. Nine were submitted to continuous intravenous infusion of perfluorocarbon-exposed sonicated dextrose albumin (PESDA) plus continuous imaging using power pulse inversion RTMCE for 180 min, associated with manually deflagrated high-mechanical index impulses. The control group consisted of 3 dogs submitted to continuous imaging using RTMCE without PESDA, 3 dogs received PESDA alone, and 3 dogs were sham-operated. Hemodynamics and cardiac rhythm were monitored continuously. Histological analysis was performed on cardiac and pulmonary tissues. No hemodynamic changes or cardiac arrhythmias were observed in any group. Normal left ventricular ejection fraction and myocardial perfusion were maintained throughout the protocol. Frequency of mild and focal microhemorrhage areas in myocardial and pulmonary tissue was similar in PESDA plus RTMCE and control groups. The percentages of positive microscopical fields in the myocardium were 0.4 and 0.7% (P = NS) in the PESDA plus RTMCE and control groups, respectively, and in the lungs they were 2.1 and 1.1%, respectively (P = NS). In this canine model, myocardial perfusion imaging obtained with PESDA and RTMCE was safe, with no alteration in cardiac rhythm or left ventricular function. Mild and focal myocardial and pulmonary microhemorrhages were observed in both groups, and may be attributed to surgical tissue manipulation.

Cytosine arabinoside-metabolizing enzyme genes are underexpressed in children with MLL gene-rearranged acute lymphoblastic leukemia

Infant acute lymphoblastic leukemia (IALL) is characterized by mixed lineage leukemia (MLL) gene rearrangements, unique gene expression profiles, poor prognosis, and drug resistance. One exception is cytosine arabinoside (Ara-C) to which IALL cells seem to be more sensitive. We quantified mRNA expression of Ara-C key enzymes in leukemic lymphoblasts from 64 Brazilian ALL children, 15 of them presenting MLL gene rearrangement, and correlated it with clinical and biological features. The diagnosis was based on morphological criteria and immunophenotyping using monoclonal antibodies. MLL gene rearrangements were detected by conventional cytogenetic analysis, RT-PCR and/or fluorescence in situ hybridization. The DCK and HENT1 expression levels were determined by real-time quantitative PCR using SYBR Green I. Relative quantification was made by the standard curve method. The results were analyzed by Mann-Whitney and Fisher exact tests. A P value of £0.05 was considered to be statistically significant. DCK and HENT1 expression levels were significantly lower in children with MLL gene-rearranged ALL compared to children with MLL germ line ALL (P = 0.0003 and 0.03, respectively). Our results differ from previous ones concerning HENT1 mRNA expression that observed a higher expression level in MLL gene-rearranged leukemias. In conclusion, the expression of the genes related to Ara-C metabolism was lower in MLL-positive children in the sample studied, suggesting the presence of population differences in the expression profile of these genes especially for HENT1.

Dynamic expression of desmin, α-SMA and TGF-β1 during hepatic fibrogenesis induced by selective bile duct ligation in young rats

We previously described a selective bile duct ligation model to elucidate the process of hepatic fibrogenesis in children with biliary atresia or intrahepatic biliary stenosis. Using this model, we identified changes in the expression of alpha smooth muscle actin (α-SMA) both in the obstructed parenchyma and in the hepatic parenchyma adjacent to the obstruction. However, the expression profiles of desmin and TGF-β1, molecules known to be involved in hepatic fibrogenesis, were unchanged when analyzed by semiquantitative polymerase chain reaction (RT-PCR). Thus, the molecular mechanisms involved in the modulation of liver fibrosis in this experimental model are not fully understood. This study aimed to evaluate the molecular changes in an experimental model of selective bile duct ligation and to compare the gene expression changes observed in RT-PCR and in real-time quantitative PCR (qRT‐PCR). Twenty-eight Wistar rats of both sexes and weaning age (21-23 days old) were used. The rats were separated into groups that were assessed 7 or 60 days after selective biliary duct ligation. The expression of desmin, α-SMA and TGF-β1 was examined in tissue from hepatic parenchyma with biliary obstruction (BO) and in hepatic parenchyma without biliary obstruction (WBO), using RT-PCR and qRT‐PCR. The results obtained in this study using these two methods were significantly different. The BO parenchyma had a more severe fibrogenic reaction, with increased α-SMA and TGF-β1 expression after 7 days. The WBO parenchyma presented a later, fibrotic response, with increased desmin expression 7 days after surgery and increased α-SMA 60 days after surgery. The qRT‐PCR technique was more sensitive to expression changes than the semiquantitative method.

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de "random primers". A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os "primers": "sense" - CGACATCGACCACCTCAAC; "antisense" - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.