Behavioral avoidance tests to evaluate effects of cattle slurry and dairy sludge application to soil¹

The application of organic wastes to agricultural soils is not risk-free and can affect soil invertebrates. Ecotoxicological tests based on the behavioral avoidance of earthworms and springtails were performed to evaluate effects of different fertilization strategies on soil quality and habitat function for soil organisms. These tests were performed in soils treated with: i) slurry and chemical fertilizers, according to the conventional fertilization management of the region, ii) conventional fertilization + sludge and iii) unfertilized reference soil. Both fertilization strategies contributed to soil acidity mitigation and caused no increase in soil heavy metal content. Avoidance test results showed no negative effects of these strategies on soil organisms, compared with the reference soil. However, results of the two fertilization managements differed: Springtails did not avoid soils fertilized with dairy sludge in any of the tested combinations. Earthworms avoided soils treated with sludge as of May 2004 (DS1), when compared with conventional fertilization. Possibly, the behavioral avoidance of earthworms is more sensitive to soil properties (other than texture, organic matter and heavy metal content) than springtails

Hydrological processes obtained on the plot scale under four simulated rainfall tests during the cycle of different crop systems

The cropping system influences the interception of water by plants, water storage in depressions on the soil surface, water infiltration into the soil and runoff. The aim of this study was to quantify some hydrological processes under no tillage cropping systems at the edge of a slope, in 2009 and 2010, in a Humic Dystrudept soil, with the following treatments: corn, soybeans, and common beans alone; and intercropped corn and common bean. Treatments consisted of four simulated rainfall tests at different times, with a planned intensity of 64 mm h-1 and 90 min duration. The first test was applied 18 days after sowing, and the others at 39, 75 and 120 days after the first test. Different times of the simulated rainfall and stages of the crop cycle affected soil water content prior to the rain, and the time runoff began and its peak flow and, thus, the surface hydrological processes. The depth of the runoff and the depth of the water intercepted by the crop + soil infiltration + soil surface storage were affected by the crop systems and the rainfall applied at different times. The corn crop was the most effective treatment for controlling runoff, with a water loss ratio of 0.38, equivalent to 75 % of the water loss ratio exhibited by common bean (0.51), the least effective treatment in relation to the others. Total water loss by runoff decreased linearly with an increase in the time that runoff began, regardless of the treatment; however, soil water content on the gravimetric basis increased linearly from the beginning to the end of the rainfall.

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

Influence of repeated applications of glyphosate on its persistence and soil bioactivity

Pesticide degradation studies are essential to evaluate its impact in the environment and on non-target organisms. The effect of repeated soil applications of the herbicide glyphosate on its dissipation and on soil microorganisms was studied by radiometric and microbial techniques. Results indicated fast dissipation of the [14C]-glyphosate or [14C]metabolites extractable residues (half-life of 0.92±0.29 month), but increasing half-lives of total mineralization ranging from 2.2 to 3.4 months as the number of applications increased from 1 to 4. No significant correlation was found between 14CO2 production and dehydrogenase activity.

Efeito do polietilenoglicol e da albumina na imobilização de lipase microbiana e na catálise em meio orgânico

Poly (ethylene) glycol (PEG) and bovine serum albumin (BSA), as additive agents, were used to enhance the activity of immobilized microbial lipase in organic solvent. Controlled pore silica (CPS) was selected as matrix and different immobilization procedures were evaluated: directly lipase binding on CPS and simultaneous addition of lipase and additive agent on the same support. The highest coupling yield (59.6%) was attained when the immobilization procedure was performed at lipase loading of 150 U/g support in the presence of PEG-1.500. This immobilized system was used in esterification reactions under repeated batch cycles and the biocatalyst half-life was found to increase 2.7 times when compared with the control.

Low metal loading catalysts used for the selective hydrogenation of styrene

A series of Group VIII metal catalysts was obtained for the semi-hydrogenation of styrene. Catalysts were characterized by Hydrogen Chemisorption, TPR and XPS. Palladium, rhodium and platinum low metal loading prepared catalysts presented high activity and selectivity (ca. 98%) during the semi-hydrogenation of styrene, being palladium the most active catalyst. The ruthenium catalyst also presented high selectivity (ca. 98%), but the lowest activity. For the palladium catalyst, the influence of the precursor salt and of the reduction temperature on the activity and selectivity were studied. The following activity series was obtained: PdN-423 > PdCl-673 > PdCl-373> PtCl-673 > RhCl-673 >> RuCl-673. As determined by XPS, differences in activity could be attributed, at least in part, to electronic effects.

Enzyme loading dependence of cellulose hydrolysis of sugarcane bagasse

The enzymatic hydrolysis of steam-pretreated sugarcane bagasse, either delignified or non-delignified, was studied as a function of enzyme loading. Hydrolysis experiments were carried out using five enzyme loadings (2.5 to 20 FPU/g cellulose) and the concentration of solids was 2% for both materials. Alkaline delignification improved cellulose hydrolysis by increasing surface area. For both materials, glucose concentrations increased with enzyme loading. On the other hand, enzyme loadings higher than 15 FPU/g did not result in any increase in the initial rate, since the excess of enzyme adsorbed onto the substrate restricted the diffusion process through the structure.

METHANE DRY REFORMING OVER Ni SUPPORTED ON PINE SAWDUST ACTIVATED CARBON: EFFECTS OF SUPPORT SURFACE PROPERTIES AND METAL LOADING

The influence of metal loading and support surface functional groups (SFG) on methane dry reforming (MDR) over Ni catalysts supported on pine-sawdust derived activated carbon were studied. Using pine sawdust as the catalyst support precursor, the smallest variety and lowest concentration of SFG led to best Ni dispersion and highest catalytic activity, which increased with Ni loading up to 3 Ni atoms nm-2. At higher Ni loading, the formation of large metal aggregates was observed, consistent with a lower "apparen" surface area and a decrease in catalytic activity. The H2/CO ratio rose with increasing reaction temperature, indicating that increasingly important side reactions were taking place in addition to MDR.

Cytopathology of callus cells infected with grapevine leafroll-associated virus 3

The cytopathology of grapevine (Vitis spp.) callus tissue infected with Grapevine leafroll-associated virus 3 (GLRaV-3), genus Vitivirus was studied in order to investigate the usefulness of callus cultures to study grapevine leafroll-associated viruses. Ultrathin sections were made from in vitro callus obtained from stems and shoots of GLRaV-3 infected grapevine plants. Callus was composed of two types of tissue. Translucent, soft callus was formed and composed of large loosely arranged cells, containing big vacuoles and a thin layer of cytoplasm. Other parts of the callus were brown-coloured and composed of small compactly arranged cells, which showed flexuous and rod-shaped closterovirus-like particles, with 10-12 nm in diameter, at higher magnifications. Groups of vesicles formed by a single membrane were also observed, with sizes ranging from 50-200 nm, containing fine fibrillar material, also typical of closterovirus infections. Virus concentration was monitored by Immunosorbent electron microscopy (ISEM) tests, which showed that in vitro culture of callus tissue from grapevine infected plants, could be used to study the GLRaV viruses through many successive generations, despite the decline in virus concentration after repeated transfers. No virus particles were observed in callus tissue obtained from healthy grapevines.

Swine effluent treatment using anaerobic digestion at different loading rates

The industrial swine production is characterized by generation of significant effluent amounts that require treatment. The most adopted practices by Brazilian swine farmers have been wastewater storage in lagoons and its subsequent use as a biofertilizer. Nutrient accumulation in soil and water creates the need for an effective management of these residues. The anaerobic digestion process is an important alternative and low-cost treatment for organic matter reduction. However, its efficiency is limited by the digester capacity of solid degradation, especially at low hydraulic retention times. Thus, the present study aimed to verify the behavior of an upflow anaerobic digester by increasing the organic loading rate. This was accomplished in three stages using, as a parameter, volatile solids at 0.5; 1.0 and 1.5 kgVS m-3 d-1, respectively. This digester model proved to be quite robust and effective in swine manure treatment, achieving high efficiency of volatile solid removal at all stages of the study (stage 1: 61.38%; stage 2: 55.18%; and stage 3: 43.18%). Biogas production was directly related to the increasing organic load, reaching 0.14, 0.85, and 0.86 Nm³ kgVS-1add., respectively, with no significant difference (p<0.05) of biogas methane concentration among the studied stages (73.7, 75.0, and 77.9%).

Mechanical damage during harvest and loading affect orange postharvest quality

Brazil is the world’s largest orange producer; however, part of this production is lost during postharvest. This loss can be minimized by controlling incidence of physical damage throughout the harvest and loading operations. Impacts can negatively modify quantitative and qualitative fruits aspects. The main goal of this study was to measure the impact magnitude in two types of harvest (manual and detachment) and during all steps from picking into bags until loading for transport to the processing industry and additionally evaluating, in laboratory, the physico-chemical quality of the fruit subjected to various impacts, similar to those found in the field. In order to evaluate the impact magnitude, an instrumented sphere was used (760 mm, Techmark, Inc, USA). The following physico-chemical parameters were evaluated during 6-days of storage: weight loss, soluble solids contents, titratable acidity, ascorbic acid content, pH, firmness and peel color. The greatest impacts were observed during harvest, during the detachment practice, and when loading and unloading from bulk storage, with average acceleration values between 249.5 and 531.52G. The impact incidence in oranges were responsible for reducing the soluble solids, titratable acidity, ascorbic acid and weight by to 5.5%; 8.7%; 4.6% and 0.5%, respectively, compared to the control. Impacts during harvest and the various pre-industry manipulation steps must be controlled as they interfere in postharvest quality and physiology of ‘Valência’ oranges.

Static tests of constructive tires using hydraulic press on the soil

ABSTRACT The power consumption and load capacity of agricultural machines have grown and the effects of pressure on the soil by tires have been still little investigated. In concern with sustainable development, the relationship machine-tire-soil must be in balance to give more consistency on the best use of tires for a given load. This study aimed to evaluate four tires of two constructive types, the bias belted tires and radial tires, both with respective rim diameters of 22.5 and 26.5 inches with variables measuring the footprint, elastic deformation, sinkage and resistance to penetration. A hydraulic press with an attachment shaft for tire mounting and a box of soil in which the tire has been imposed on a load of 53.00 kN using nominal pressures recommended by the tire manufacturer. The radial construction tire with rim diameter of 26.5 inches obtained less sinkage and resistance to penetration; however, greater elastic deformation and footprint compared to other tires. The bias-belted tire with 22.5-inch rim presented the highest resistance to penetration and the lowest elastic deformation.

Complex pulmonary aspergilloma treated by cavernostomy

Objective: To evaluate the effectiveness of cavernostomy in patients with complex fungal balls.Methods: We analyzed the medical records of patients undergoing cavernostomy between January 2005 and May 2013, evaluating: age, gender, preoperative signs and symptoms, predisposing disease, preoperative tests, location of the aspergilloma, etiologic agent, cavernostomy indication, postoperative outcome.Results: Ten patients were male. The mean age was 42.9 years (34-56). The most frequent symptom was repeated pulmonary bleeding. Cavernostomy was proposed for patients at high risk for lung resection. It was performed in 17 patients and all of them had pulmonary tuberculosis sequelae, with cavitations. The indication in all cases was hemoptysis and elimination of phlegm. The cavernostomies were performed in a single surgical procedure. In all 17 patients the cavity was left open after the withdrawal of the mycetoma. In all patients hemoptysis ceased immediately. Operative mortality was 9.5% (1).Conclusion: cavernostomy is an effective treatment alternative in patients at high risk. It may be useful in some patients with complex aspergilloma, irrespective of lung function or bilateral disease. It is technically easy, has low-risk, saves parenchyma, and may be performed in a single operative time.

Quality Indicators of Cervical Cytopathology Tests in the Public Service in Minas Gerais, Brazil

Objective The objective of this study is to assess the performance of cytopathology laboratories providing services to the Brazilian Unified Health System (Sistema Único de Saúde - SUS) in the State of Minas Gerais, Brazil. Methods This descriptive study uses data obtained from the Cervical Cancer Information System from January to December 2012. Three quality indicators were analyzed to assess the quality of cervical cytopathology tests: positivity index, percentage of atypical squamous cells (ASCs) in abnormal tests, and percentage of tests compatiblewith high-grade squamous intraepithelial lesions (HSILs). Laboratories were classified according to their production scale in tests per year≤5,000; from 5,001 to 10,000; from 10,001 to 15,000; and 15,001. Based on the collection of variables and the classification of laboratories according to production scale, we created and analyzed a database using Microsoft Office Excel 97-2003. Results In the Brazilian state of Minas Gerais, 146 laboratories provided services to the SUS in 2012 by performing a total of 1,277,018 cervical cytopathology tests. Half of these laboratories had production scales≤5,000 tests/year and accounted for 13.1% of all tests performed in the entire state; in turn, 13.7% of these laboratories presented production scales of > 15,001 tests/year and accounted for 49.2% of the total of tests performed in the entire state. The positivity indexes of most laboratories providing services to the SUS in 2012, regardless of production scale, were below or well below recommended limits. Of the 20 laboratories that performed more than 15,001 tests per year, only three presented percentages of tests compatible with HSILs above the lower limit recommended by the Brazilian Ministry of Health. Conclusion The majority of laboratories providing services to the SUS in Minas Gerais presented quality indicators outside the range recommended by the Brazilian Ministry of Health.

Predictive Capability of HPV and Pap Tests in Screening for Cervical Cancer over a Three-Year Follow-up

Purpose To compare the predictive capability of HPV and Pap smear tests for screening pre-cancerous lesions of the cervix over a three-year follow-up, in a population of users of the Brazilian National Health System (SUS). Methods This is a retrospective cohort study of 2,032 women with satisfactory results for Pap smear and HPV tests using second-generation hybrid capture,made in a previous study. We followed them for 36 months with data obtained from medical records, the Cervix Cancer Information System (SISCOLO), and the Mortality Information System (SIM). The outcome was a histological diagnosis of cervical intraepithelial neoplasia grade 2 or more advanced lesions (CIN2ş). We constructed progression curves of the baseline test results for the period, using the Kaplan-Meier method, and estimated sensitivity, specificity, positive and negative predictive value, and positive and negative likelihood ratios for each test. Results A total of 1,440 women had at least one test during follow-up. Progression curves of the baseline test results indicated differences in capability to detect CIN2ş (p < 0.001) with significantly greater capability when both tests were abnormal, followed by only a positive HPV test. The HPV test was more sensitive than the Pap smear (88.7% and 73.6%, respectively; p < 0.05) and had a better negative likelihood ratio (0.13 and 0.30, respectively). Specificity and positive likelihood ratio of the tests were similar. Conclusions These findings corroborate the importance of HPV test as a primary cervical cancer screening.