169 resultados para Host immune response


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The present paper describes important features of the immune response induced by the Cry1Ac protein from Bacillus thuringiensis in mice. The kinetics of induction of serum and mucosal antibodies showed an immediate production of anti-Cry1Ac IgM and IgG antibodies in serum after the first immunization with the protoxin by either the intraperitoneal or intragastric route. The antibody fraction in serum and intestinal fluids consisted mainly of IgG1. In addition, plasma cells producing anti-Cry1Ac IgG antibodies in Peyer's patches were observed using the solid-phase enzyme-linked immunospot (ELISPOT). Cry1Ac toxin administration induced a strong immune response in serum but in the small intestinal fluids only anti-Cry1Ac IgA antibodies were detected. The data obtained in the present study confirm that the Cry1Ac protoxin is a potent immunogen able to induce a specific immune response in the mucosal tissue, which has not been observed in response to most other proteins.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

There is increasing interest in the immune response induced by plant viruses since these could be used as antigen-expressing systems in vaccination procedures. Cowpea severe mosaic virus (CPSMV), as a purified preparation (300 g of leaves, 2 weeks post-inoculation), or crude extract from cowpea (Vigna unguiculata) leaves infected with CPSMV both administered by gavage to Swiss mice induced a humoral immune response. Groups of 10 Swiss mice (2-month-old females) were immunized orally with 10 daily doses of either 50 µg viral capsid protein (boosters of 50 µg at days 21 and 35 after immunization) or 0.6 mg protein of the crude extract (boosters of 0.6 mg at days 21 and 35 after immunization). Anti-CPSMV antibodies were quantified by ELISA in pooled sera diluted at least 1:400 at days 7, 14, 21, 28, 35 and 42 after the 10th dose. IgG and IgA against CPSMV were produced systemically, but IgE was not detected. No synthesis of specific antibodies against the proteins of leaf extracts from V. unguiculata, infected or not with CPSMV, was detected. The use of CPSMV, a plant-infecting virus that apparently does not induce a pathogenic response in animals, induced a humoral and persistent (at least 6 months) immune response through the administration of low antigen doses by gavage. These results raise the possibility of using CPSMV either as a vector for the production of vaccines against animal pathogens or in quick and easy methods to produce specific antisera for viral diagnosis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

We have evaluated the cellular and humoral immune response to primary respiratory syncytial virus (RSV) infection in young infants. Serum specimens from 65 patients <=12 months of age (39 males and 26 females, 28 cases <3 months and 37 cases > or = 3 months; median 3 ± 3.9 months) were tested for anti-RSV IgG and IgG subclass antibodies by EIA. Flow cytometry was used to characterize cell surface markers expressed on peripheral blood mononuclear cells (PBMC) from 29 RSV-infected children. There was a low rate of seroconversion in children <3 months of age, whose acute-phase PBMC were mostly T lymphocytes (63.0 ± 9.0%). In contrast, a higher rate of seroconversion was observed in children >3 months of age, with predominance of B lymphocytes (71.0 ± 17.7%). Stimulation of PBMC with RSV (2 x 10(5) TCID50) for 48 h did not induce a detectable increase in intracellular cytokines and only a few showed a detectable increase in RSV-specific secreted cytokines. These data suggest that age is an important factor affecting the infants' ability to develop an immune response to RSV.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Patients with gastric cancer have a variety of immunological abnormalities. In the present study the lymphocytes and their subsets were determined in the peripheral blood of patients with gastric cancer (N = 41) both before and after surgical treatment. The percent of helper/inducer CD4 T cells (43.6 ± 8.9) was not different after tumor resection (43.6 ± 8.2). The percent of the cytotoxic CD8+ T cell population decreased significantly, whether patients were treated surgically (27.2 ± 5.8%, N = 20) or not (27.3 ± 7.3%, N = 20) compared to individuals with inflammatory disease (30.9 ± 7.5%) or to healthy individuals (33.2 ± 7.6%). The CD4/CD8 ratio consequently increased in the group of cancer patients. The peripheral blood lymphocytes of gastric cancer patients showed reduced responsiveness to mitogens. The defective blastogenic response of the lymphocytes was not associated with the production of transforming growth factor beta (TGF-ß) since the patients with cancer had reduced production of TGF-ß1 (269 ± 239 pg/ml, N = 20) in comparison to the normal individuals (884 ± 175 pg/ml, N = 20). These results indicate that the immune response of gastric cancer patients was not significantly modified by surgical treatment when evaluated four weeks after surgery and that the immunosuppression observed was not due to an increase in TGF-ß1 production by peripheral leukocytes.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Pathogens causing tuberculosis and other chronic infectious diseases of major public health importance commonly have complex mechanisms involved in their persistence in the host despite specific and sometimes strong immune responses. These diseases are also associated with the lack of efficient vaccines, difficult therapeutics and a high mortality rate among susceptible individuals. Here, we will review features of the host immune response that contribute to the occurrence of disease. In addition, we propose that the immune responses observed in tuberculosis cannot be interpreted solely on the basis of a Th1-Th2 counter-regulatory paradigm since there is growing evidence that natural regulatory T cells may play an important role in the regulation of host immune responses against Mycobacterium tuberculosis. Thus, the development of more effective vaccines against this bacterial disease should take into account the role of natural regulatory T cells in the progression to severe disease and persistence of infection. Finally, new treatments based on manipulation of regulatory T cells should be investigated.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Human cytomegalovirus (CMV) infection is common in most people but nearly asymptomatic in immunocompetent individuals. After primary infection the virus persists throughout life in a latent form in a variety of tissues, particularly in precursor cells of the monocytic lineage. CMV reinfection and occurrence of disease are associated with immunosuppressive conditions. Solid organ and bone marrow transplant patients are at high risk for CMV disease as they undergo immunosuppression. Antiviral treatment is effective in controlling viremia, but 10-15% of infected patients can experience CMV disease by the time the drug is withdrawn. In addition, long-term antiviral treatment leads to bone marrow ablation and renal toxicity. Furthermore, control of chronic CMV infection in transplant recipients appears to be dependent on the proper recovery of cellular immunity. Recent advances in the characterization of T-cell functions and identification of distinct functional signatures of T-cell viral responses have opened new perspectives for monitoring transplant individuals at risk of developing CMV disease.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Two recombinant baculoviruses were produced in order to obtain a bovine viral diarrhea virus (BVDV) immunogen: AcNPV/E2 expressing E2 glycoprotein, and AcNPV/E0E1E2 expressing the polyprotein region coding for the three structural proteins of BVDV (E0, E1, and E2). Mice were immunized with Sf9 cells infected with the recombinant baculoviruses in a water in oil formulation and the production of neutralizing antibodies was evaluated. Since E2 elicited higher neutralizing antibody titers than E0-E1-E2 polyprotein, it was selected to immunize cattle. Calves received two doses of recombinant E2 vaccine and were challenged with homologous BVDV 37 days later. The recombinant immunogen induced neutralizing titers which showed a mean value of 1.5 ± 0.27 on the day of challenge and reached a top value of 3.36 ± 0.36, 47 days later (84 days post-vaccination). On the other hand, sera from animals which received mock-infected Sf9 cells did not show neutralizing activity until 25 days post-challenge (62 days post-vaccination), suggesting that these antibodies were produced as a consequence of BVDV challenge. Even when no total protection was observed in cattle, in vitro viral neutralization assays revealed that the recombinant immunogen was able to induce neutralizing antibody synthesis against the homologous strain as well as against heterologous strains in a very efficient way.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The aim of the present study was to determine whether lipoarabinomannan (LAM), in combination with Freund’s incomplete adjuvant (FIA), was able to improve cell-mediated and antibody-mediated immune responses against ovalbumin (OVA) in cattle. Twenty-three calves were assigned to four treatment groups, which were subcutaneously immunized with either OVA plus FIA, OVA plus FIA and LAM from Mycobacterium avium subsp avium, FIA plus LAM, or FIA alone. Lymphoproliferation, IFN-γ production and cell subpopulations on peripheral blood mononuclear cells before and 15 days after treatment were evaluated. Delayed hypersensitivity was evaluated on day 57. Specific humoral immune response was measured by ELISA. Inoculation with LAM induced higher levels of lymphoproliferation and IFN-γ production in response to ConA and OVA (P < 0.05). Specific antibody titers were similar in both OVA-immunized groups. Interestingly, our results showed that the use of LAM in vaccine preparations improved specific cell immune response evaluated by lymphoproliferation and IFN-γ production by at least 50 and 25%, respectively, in cattle without interfering with tuberculosis and paratuberculosis diagnosis.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Paracoccidioidomycosis is an endemic fungal disease widely distributed throughout Latin America. The potent immunosuppressor cyclophosphamide (CY) has been used to modulate host immune response to Paracoccidioides brasiliensis in an experimental model. Inbred male Buffalo/Sim rats weighing 250-300 g were inoculated with 5 x 10(6) P. brasiliensis cells of the yeast phase form by intracardiac route. One group of animals was treated with 20 mg/kg body weight at days +4, +5, +6, +7, +11 and +12 post-infection (pi.), while a control group was infected alone. No mortality was recorded in either group. Treated rats presented: a) a decrease in granuloma size, which contained less fungal cells; b) a lack of specific antibodies up to 35 days pi., and c) a significant increase in the footpad swelling test (DTH) against paracoccidioidin. Splenic cell transfer from CY-treated P. brasiliensis-infected donors to recipients infected alone led to a significant increase in DTH response in the latter versus untreated infected controls. Likewise, in treated infected recipients transferred with untreated infected donor spleen cells, footpad swelling proved greater than in controls. Thus, it would seem that each successive suppressor T lymphocyte subset belonging to the respective cascade may be sensitive to repeated CY doses administered up to 12 days pi.. Alternatively, such CY schedule may induce the appearance of a T cell population capable of amplifying DTH response.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The involvement of the central nervous system (CNS) by schistosomes may or may not determine clinical manifestations. When symptomatic, neuroschistosomiasis (NS) is one of the most severe presentations of schistosomal infection. Considering the symptomatic form, cerebral involvement is almost always due to Schistosoma japonicum and the spinal cord disease, caused by S. mansoni or S. haematobium. Available evidence suggests that NS depends basically on the presence of parasite eggs in the nervous tissue and on the host immune response. The patients with cerebral NS usually have the clinical manifestations of increased intracranial pressure associated with focal neurological signs; and those with schistosomal myeloradiculopathy (SMR) present rapidly progressing symptoms of myelitis involving the lower cord, usually in association with the involvement of the cauda esquina roots. The diagnosis of cerebral NS is established by biopsy of the nervous tissue and SMR is usually diagnosed according to a clinical criterion. Antischistosomal drugs, corticosteroids and surgery are the resourses available for treating NS. The outcome is variable and is better in cerebral disease.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Malaria emerges from a disequilibrium of the system 'human-plasmodium-mosquito' (HPM). If the equilibrium is maintained, malaria does not ensue and the result is asymptomatic plasmodium infection. The relationships among the components of the system involve coadaptive linkages that lead to equilibrium. A vast body of evidence supports this assumption, including the strategies involved in the relationships between plasmodium and human and mosquito immune systems, and the emergence of resistance of plasmodia to antimalarial drugs and of mosquitoes to insecticides. Coadaptive strategies for malaria control are based on the following principles: (1) the system HPM is composed of three highly complex and dynamic components, whose interplay involves coadaptive linkages that tend to maintain the equilibrium of the system; (2) human and mosquito immune systems play a central role in the coadaptive interplay with plasmodium, and hence, in the mainten-ance of the system's equilibrium; the under- or overfunction of human immune system may result in malaria and influence its severity; (3) coadaptation depends on genetic and epigenetic phenomena occurring at the interfaces of the components of the system, and may involve exchange of infectrons (genes or gene fragments) between the partners; (4) plasmodia and mosquitoes have been submitted to selective pressures, leading to adaptation, for an extremely long while and are, therefore, endowed with the capacity to circumvent both natural (immunity) and artificial (drugs, insecticides, vaccines) measures aiming at destroying them; (5) since malaria represents disequilibrium of the system HPM, its control should aim at maintaining or restoring this equilibrium; (6) the disequilibrium of integrated systems involves the disequilibrium of their components, therefore the maintenance or restoration of the system's equilibrium depend on the adoption of integrated and coordinated measures acting on all components, that means, panadaptive strategies. Coadaptive strategies for malaria control should consider that: (1) host immune response has to be induced, since without it, no coadaptation is attained; (2) the immune response has to be sustained and efficient enough to avoid plasmodium overgrowth; (3) the immune response should not destroy all parasites; (4) the immune response has to be well controlled in order to not harm the host. These conditions are mostly influenced by antimalarial drugs, and should also be taken into account for the development of coadaptive malaria vaccines.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This study was carried out to evaluate the molecular pattern of all available Brazilian human T-cell lymphotropic virus type 1 Env (n = 15) and Pol (n = 43) nucleotide sequences via epitope prediction, physico-chemical analysis, and protein potential sites identification, giving support to the Brazilian AIDS vaccine program. In 12 previously described peptides of the Env sequences we found 12 epitopes, while in 4 peptides of the Pol sequences we found 4 epitopes. The total variation on the amino acid composition was 9 and 17% for human leukocyte antigen (HLA) class I and class II Env epitopes, respectively. After analyzing the Pol sequences, results revealed a total amino acid variation of 0.75% for HLA-I and HLA-II epitopes. In 5 of the 12 Env epitopes the physico-chemical analysis demonstrated that the mutations magnified the antigenicity profile. The potential protein domain analysis of Env sequences showed the loss of a CK-2 phosphorylation site caused by D197N mutation in one epitope, and a N-glycosylation site caused by S246Y and V247I mutations in another epitope. Besides, the analysis of selection pressure have found 8 positive selected sites (w = 9.59) using the codon-based substitution models and maximum-likelihood methods. These studies underscore the importance of this Env region for the virus fitness, for the host immune response and, therefore, for the development of vaccine candidates.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Lentinus strigosus (Pegler 1983) (Polyporaceae, basidiomycete) was selected in a screen for inhibitory activity on Trypanosoma cruzi trypanothione reductase (TR). The crude extract of L. strigosus was able to completely inhibit TR at 20 µg/ml. Two triquinane sesquiterpenoids (dihydrohypnophilin and hypnophilin), in addition to two panepoxydol derivatives (neopanepoxydol and panepoxydone), were isolated using a bioassay-guided fractionation protocol. Hypnophilin and panepoxydone displayed IC50 values of 0.8 and 38.9 µM in the TR assay, respectively, while the other two compounds were inactive. The activity of hypnophilin was confirmed in a secondary assay with the intracellular amastigote forms of T. cruzi, in which it presented an IC50 value of 2.5 µ M. Quantitative flow cytometry experiments demonstrated that hypnophilin at 4 µM also reduced the proliferation of human peripheral blood monocluear cells (PBMC) stimulated with phytohemaglutinin, without any apparent interference on the viability of lymphocytes and monocytes. As the host immune response plays a pivotal role in the adverse events triggered by antigen release during treatment with trypanocidal drugs, the ability of hypnophilin to kill the intracellular forms of T. cruzi while modulating human PBMC proliferation suggests that this terpenoid may be a promising prototype for the development of new chemotherapeutical agents for Chagas disease.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Severe forms of dengue, such as dengue haemorrhagic fever (DHF) and dengue shock syndrome, are examples of a complex pathogenic mechanism in which the virus, environment and host immune response interact. The influence of the host's genetic predisposition to susceptibility or resistance to infectious diseases has been evidenced in several studies. The association of the human leukocyte antigen gene (HLA) class I alleles with DHF susceptibility or resistance has been reported in ethnically and geographically distinct populations. Due to these ethnic and viral strain differences, associations occur in each population, independently with a specific allele, which most likely explains the associations of several alleles with DHF. As the potential role of HLA alleles in the progression of DHF in Brazilian patients remains unknown, we then identified HLA-A alleles in 67 patients with dengue fever and 42 with DHF from Rio de Janeiro, Brazil, selected from 2002-2008 by the sequence-based typing technique. Statistical analysis revealed an association between the HLA-A*01 allele and DHF [odds ratio (OR) = 2.7, p = 0.01], while analysis of the HLA-A*31 allele (OR = 0.5, p = 0.11) suggested a potential protective role in DHF that should be further investigated. This study provides evidence that HLA class I alleles might be important risk factors for DHF in Brazilian patients.