Interleukin-15 as a potential regulator of the innate immune response

Interleukin-15 (IL-15) is a newly-discovered cytokine that is produced by activated monocytes early in the course of the innate immune response. IL-15 is able to bind to components of the interleukin-2 receptor (IL-2R) despite the fact that it has no sequence homology with IL-2. IL-15 stimulates human natural killer cell proliferation, cytotoxicity, and cytokine production and can substitute for IL-2 under most conditions. In vitro studies indicate that monocyte-derived IL-15 may be an important determinant of IFN-gamma production by NK cells. In addition, IL-15 is able to promote the survival of natural killer cells under serum-free conditions. The IL-15 receptor is a heterotrimeric complex which is composed of the IL-2Rß and g chains in combination with a unique alpha chain (IL-15a). The IL-15Ra chain has strong sequence homology to the IL-2Ra chain and confers high affinity binding to the IL-15R. In contrast to IL-2, transcript for IL-15 and IL-15a is expressed in a number of tissues and indicates that IL-15 may be an important ligand for cells that express components of the IL-2R

Characterization of the mucosal and systemic immune response induced by Cry1Ac protein from Bacillus thuringiensis HD 73 in mice

The present paper describes important features of the immune response induced by the Cry1Ac protein from Bacillus thuringiensis in mice. The kinetics of induction of serum and mucosal antibodies showed an immediate production of anti-Cry1Ac IgM and IgG antibodies in serum after the first immunization with the protoxin by either the intraperitoneal or intragastric route. The antibody fraction in serum and intestinal fluids consisted mainly of IgG1. In addition, plasma cells producing anti-Cry1Ac IgG antibodies in Peyer's patches were observed using the solid-phase enzyme-linked immunospot (ELISPOT). Cry1Ac toxin administration induced a strong immune response in serum but in the small intestinal fluids only anti-Cry1Ac IgA antibodies were detected. The data obtained in the present study confirm that the Cry1Ac protoxin is a potent immunogen able to induce a specific immune response in the mucosal tissue, which has not been observed in response to most other proteins.

Effect of surgical treatment on the cellular immune response of gastric cancer patients

Patients with gastric cancer have a variety of immunological abnormalities. In the present study the lymphocytes and their subsets were determined in the peripheral blood of patients with gastric cancer (N = 41) both before and after surgical treatment. The percent of helper/inducer CD4 T cells (43.6 ± 8.9) was not different after tumor resection (43.6 ± 8.2). The percent of the cytotoxic CD8+ T cell population decreased significantly, whether patients were treated surgically (27.2 ± 5.8%, N = 20) or not (27.3 ± 7.3%, N = 20) compared to individuals with inflammatory disease (30.9 ± 7.5%) or to healthy individuals (33.2 ± 7.6%). The CD4/CD8 ratio consequently increased in the group of cancer patients. The peripheral blood lymphocytes of gastric cancer patients showed reduced responsiveness to mitogens. The defective blastogenic response of the lymphocytes was not associated with the production of transforming growth factor beta (TGF-ß) since the patients with cancer had reduced production of TGF-ß1 (269 ± 239 pg/ml, N = 20) in comparison to the normal individuals (884 ± 175 pg/ml, N = 20). These results indicate that the immune response of gastric cancer patients was not significantly modified by surgical treatment when evaluated four weeks after surgery and that the immunosuppression observed was not due to an increase in TGF-ß1 production by peripheral leukocytes.

Impairment of cytomegalovirus-specific cellular immune response as a risk factor for cytomegalovirus disease in transplant recipients

Human cytomegalovirus (CMV) infection is common in most people but nearly asymptomatic in immunocompetent individuals. After primary infection the virus persists throughout life in a latent form in a variety of tissues, particularly in precursor cells of the monocytic lineage. CMV reinfection and occurrence of disease are associated with immunosuppressive conditions. Solid organ and bone marrow transplant patients are at high risk for CMV disease as they undergo immunosuppression. Antiviral treatment is effective in controlling viremia, but 10-15% of infected patients can experience CMV disease by the time the drug is withdrawn. In addition, long-term antiviral treatment leads to bone marrow ablation and renal toxicity. Furthermore, control of chronic CMV infection in transplant recipients appears to be dependent on the proper recovery of cellular immunity. Recent advances in the characterization of T-cell functions and identification of distinct functional signatures of T-cell viral responses have opened new perspectives for monitoring transplant individuals at risk of developing CMV disease.

Attenuation of phosphamidon-induced oxidative stress and immune dysfunction in rats treated with N-acetylcysteine

The effect of N-acetylcysteine, a thiolic antioxidant, on attenuation of phosphamidon-induced oxidative stress and immune dysfunction was evaluated in adult male Wistar rats weighing 200-250 g. Rats were divided into four groups, 8 animals/group, and treated with phosphamidon, N-acetylcysteine or the combination of both for 28 days. Oral administration of phosphamidon (1.74 mg/kg), an organophosphate insecticide, increased serum malondialdehyde (3.83 ± 0.18 vs 2.91 ± 0.24 nmol/mL; P < 0.05) and decreased erythrocyte superoxide dismutase (567.8 ± 24.36 vs 749.16 ± 102.61 U/gHb; P < 0.05), catalase activity (1.86 ± 0.18 vs 2.43 ± 0.08 U/gHb; P < 0.05) and whole blood glutathione levels (1.25 ± 0.21 vs 2.28 ± 0.08 mg/gHb; P < 0.05) showing phosphamidon-induced oxidative stress. Phosphamidon exposure markedly suppressed humoral immune response as assessed by antibody titer to ovalbumin (4.71 ± 0.51 vs 8.00 ± 0.12 -log2; P < 0.05), and cell-mediated immune response as assessed by leukocyte migration inhibition (25.24 ± 1.04 vs 70.8 ± 1.09%; P < 0.05) and macrophage migration inhibition (20.38 ± 0.99 vs 67.16 ± 5.30%; P < 0.05) response. Phosphamidon exposure decreased IFN-у levels (40.7 ± 3.21 vs 55.84 ± 3.02 pg/mL; P < 0.05) suggesting a profound effect of phosphamidon on cell-mediated immune response. A phosphamidon-induced increase in TNF-α level (64.19 ± 6.0 vs 23.16 ± 4.0 pg/mL; P < 0.05) suggests a contributory role of immunocytes in oxidative stress. Co-administration of N-acetylcysteine (3.5 mmol/kg, orally) with phosphamidon attenuated the adverse effects of phosphamidon. These findings suggest that oral N-acetylcysteine treatment exerts protective effect and attenuates free radical injury and immune dysfunction caused by subchronic phosphamidon exposure.

Association among genetic predisposition, gut microbiota, and host immune response in the etiopathogenesis of inflammatory bowel disease

Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), is a chronic disorder that affects thousands of people around the world. These diseases are characterized by exacerbated uncontrolled intestinal inflammation that leads to poor quality of life in affected patients. Although the exact cause of IBD still remains unknown, compelling evidence suggests that the interplay among immune deregulation, environmental factors, and genetic polymorphisms contributes to the multifactorial nature of the disease. Therefore, in this review we present classical and novel findings regarding IBD etiopathogenesis. Considering the genetic causes of the diseases, alterations in about 100 genes or allelic variants, most of them in components of the immune system, have been related to IBD susceptibility. Dysbiosis of the intestinal microbiota also plays a role in the initiation or perpetuation of gut inflammation, which develops under altered or impaired immune responses. In this context, unbalanced innate and especially adaptive immunity has been considered one of the major contributing factors to IBD development, with the involvement of the Th1, Th2, and Th17 effector population in addition to impaired regulatory responses in CD or UC. Finally, an understanding of the interplay among pathogenic triggers of IBD will improve knowledge about the immunological mechanisms of gut inflammation, thus providing novel tools for IBD control.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Human cryptosporidiosis: detection of specific antibodies in the serum by an indirect immunofluorescence

Cryptosporidium sp., a coccidian parasite usually found in the faeces of cattle, has been recently implicated as an agent of human intestinal disease, mainly in immunocompromised patients. In the study realized, by an indirect immunofluorescence technique, specific immunoglobulins (IgG and IgM) have been demonstrated in human serum against Cryptosporidium oocysts. Purified oocysts were used as antigens in the indirect immunofluorecence assay. After analyzing this test in sera from selected groups of patients, the frequency of both specific IgG and IgM of immunocompetent children who were excreting oocysts in their faeces was 62% and in children with negative excretion of oocysts was 20% and 40%, respectively. In adults infected with the human immunodeficiency virus (HIV) and who were excreting Cryptosporidium in their stools, the frequency was 57% for IgG but only 2% for IgM. Twenty three percent of immunocompromised adults with not determined excretion of oocysts in their stools had anti-Cryptosporidium IgG in their sera. Children infected with human immunodeficiency virus had no IgM and only 14% had IgG detectable in their sera. The indirect immunoflorescence assay, when used with other parasitological techniques appears to be useful for retrospective population studies and for diagnosis of acute infection. The humoral immune response of HIV positive patients to this protozoan agent needs clarification.

Immunoserology of malaria

This literature review discusses the most frequently used serodiagnostic methods for the determination of the humoral immune response to malarial parasites. The importance of malaria as a global public health problem is stressed in the light of the new discoveries leading to the future development of an anti-malarial vaccine suitable for use in humans. Serological techniques are expected to play an important role in the assessment of the relative efficacy of these candidate vaccines. A discussion of the different antigen preparation techniques is also presented.

Reduced schedule of human anti rabies immunization with Fuenzalida & Palacios vaccine

The present study evaluates the humoral and cellular immune responses in 35 volunteers submited to short antirabies vaccination schedules with the Fuenzalida & Palacios vaccine based on the administration of doses on non consecutive days. The volunteers were divided into two groups. The first group received a total number of five doses given on days 0, 4, 7, 20 and 35. The other group received four doses, the first one being a double dose given on day 0 and than three other single doses on days 7, 20 and 35. The evaluation of humoral immune response was carried out by serum neutralization (SN) and indirect immunofluorescense (IIF) tests, while the cellular immune response was evaluated by lymphoblastic transformation assay (LTA) and skin test (ST). According to our results these reduced schedules elicited early and effective humoral and cellulafimmune responses to rabies antigen suggesting that new reduced schedules should be extensively studied in order to give the proper bases to the proposition of changes in the current long-term schedule.

Natural killer cell activity in experimental paracoccidioidomycosis of the Syrian hamster

The study evaluated the activity of NK cells during the course of experimental infection of hamsters with Paracoccidioides brasiliensis. Eigthy hamsters were infected with P. brasiliensis by intratesticular route and sacrificed at 24h, 48h, 96h, 1, 2, 4, 8 and 11 weeks of infection and compared to 40 noninfected hamsters employed as controls. These animals were submitted to the study of NK cytotoxic activity by a single-cell assay and humoral immune response by immunodiffusion and ELISA tests. The production of macrophage migration inhibitory factor in the presence of Phyto-hemagglutinin and P. brasiliensis antigen and histopathology of the lesions were evaluated at 1, 4, 8 and 11 weeks of infection. The infected animals displayed significantly high levels of NK activity during the four weeks of infection that decreased from the 8th week on when compared to controls. This impairment of NK activity was associated with depression of cell-mediated immune response and with increase in the extension of the histopathologic lesions. There was an inverse correlation between NK cell activity and specific antibody levels. The results suggest that after initial activation, NK cells were unable to control the fungus dissemination. The impairment of NK activity in the late stages of the infection might be related to immunoregulatory disturbances associated with paracoccidioidomycosis.

Immunoprecipitation techniques and Elisa in the detection of anti-Fonsecaea pedrosoi antibodies in chromoblastomycosis

Chromoblastomycosis (CBM) is a chronic subcutaneous infection caused by several dematiaceous fungi. The most commonly etiological agent found in Brazil is Fonsecaea pedrosoi, which appears as thick walled, brownish colored cells with transverse and longitudinal division in the lesions, called "muriform cells". This disease is found worldwide but countries like Madagascar and Brazil have highest incidence. Diagnosis is made by clinical, direct and histopathologic examination and culture of specimens. Serological tests have been used to identify specific antibodies against Fonsecaea pedrosoi antigens, as well as immunotechniques have been used for CBM serological identification and diagnosis. In the present study double immunodiffusion (DID), counterimmunoelectrophoresis (CIE) and immunoenzymatic test (ELISA) have been used to evaluate humoral immune response in patients with CBM caused by F. pedrosoi. Metabolic antigen was used for immunoprecipitation tests (DID and CIE) while somatic antigen for ELISA. Our results demonstrated 53% sensitivity and 96% specificity for DID, while CIE presented 68% sensitivity and 90.5% specificity. ELISA demonstrated 78% sensibility and 83% specificity. Serological tests can be a useful tool to study different aspects of CBM, such as helping differential diagnosis, when culture of the pathogenic agent is impossible.

CD19 LYMPHOCYTE PROLIFERATION INDUCED BY Bifidobacterium animalis subsp. lactis IN C57BL/6 MICE EXPERIMENTALLY INFECTED WITH Toxoplasma gondii

Toxoplasmosis is frequently acquired through the oral route by the ingestion of cysts or oocysts of Toxoplasma gondii. Once ingested, the parasites penetrate the intestinal epithelial cells and rapidly disseminate to all organs in the host. During T. gondii infection, the intestinal microbiota plays an important role in stimulating a protective immune response against the parasite. In this sense the use of probiotics is worthy of note since they are live microorganisms that have beneficial effects on the host through stimulation of the immune response that can be important in the control of T. gondii proliferation and dissemination in the host. In the present study, the action of the probiotic Bifidobacterium animalis subsp. lactis was investigated in C57BL/6 mice infected with oocysts of ME49 strain of T. gondii. The probiotic had an immunomodulatory action, inducing CD19 lymphocyte proliferation and consequently increasing anti-T. gondii antibody level.Bifidobacterium animalis subsp. lactisprovided protection in supplemented mice, compared to the control group. In addition, supplemented animals had milder inflammatory process in the small intestine, indicating that the probiotic protects the intestinal mucosa during infection with T. gondii. It was concluded that the probioticB. animalis subsp. lactis induces humoral immune response capable of providing protection against T. gondii infection.

Effect of a booster-dose of rabies vaccine on the duration of virus neutralizing antibody titers in bovines

Humoral immune response using inactivated rabies vaccine was studied in 35 nelore cross-bred bovines of western region of São Paulo state. Ninety days after vaccination, 13 (92.8%) animals presented titers 30.5IU/ml, through mouse neutralization test. After 180 days, 9 (64.3%) sera showed titers 30.5IU/ml, after 270 days, only one (7.1%) showed a titer of 0.51IU/ml, and after 360 days, all animals showed titers < 0.5IU/ml. Group of animals receiving booster dose 30 days after vaccination presented, two months after, all with titers > 0.5IU/ml. At 180 days, 17 (80.9%) sera presented titers > 0.5IU/ml; at 270 days, 15 (71.4%), with titers 30.5IU/ml and at 360 days, 4 (19.0%), with titers 30.5IU/ml. Booster-dose ensured high levels of neutralizing antibodies for at least three months, and 240 days after revaccination, 71.4% of animals were found with titers 30.5IU/ml.

Carbohydrate-rich high-molecular-mass antigens are strongly recognized during experimental Histoplasma capsulatum infection

INTRODUCTION: During histoplasmosis, Histoplasma capsulatum soluble antigens (CFAg) can be naturally released by yeast cells. Because CFAg can be specifically targeted during infection, in the present study we investigated CFAg release in experimental murine histoplasmosis, and evaluated the host humoral immune response against high-molecular-mass antigens (hMMAg. >150 kDa), the more immunogenic CFAg fraction. METHODS: Mice were infected with 2.2x10(4) H. capsulatum IMT/HC128 yeast cells. The soluble CFAg, IgG anti-CFAg, IgG anti-hMMAg, and IgG-hMMAg circulating immune complexes (CIC) levels were determined by enzymelinked immunosorbent assay, at days 0, 7, 14, and 28 post-infection. RESULTS: We observed a progressive increase in circulating levels of CFAg, IgG anti-CFAg, IgG anti-hMMAg, and IgG-hMMAg CIC after H. capsulatum infection. The hMMAg showed a high percentage of carbohydrates and at least two main immunogenic components. CONCLUSIONS: We verified for the first time that hMMAg from H. capsulatum IMT/HC128 strain induce humoral immune response and lead to CIC formation during experimental histoplasmosis.