Hydrogen sulfide postconditioning protects isolated rat hearts against ischemia and reperfusion injury mediated by the JAK2/STAT3 survival pathway

The JAK2/STAT3 signal pathway is an important component of survivor activating factor enhancement (SAFE) pathway. The objective of the present study was to determine whether the JAK2/STAT3 signaling pathway participates in hydrogen sulfide (H2S) postconditioning, protecting isolated rat hearts from ischemic-reperfusion injury. Male Sprague-Dawley rats (230-270 g) were divided into 6 groups (N = 14 per group): time-matched perfusion (Sham) group, ischemia/reperfusion (I/R) group, NaHS postconditioning group, NaHS with AG-490 group, AG-490 (5 µM) group, and dimethyl sulfoxide (DMSO; <0.2%) group. Langendorff-perfused rat hearts, with the exception of the Sham group, were subjected to 30 min of ischemia followed by 90 min of reperfusion after 20 min of equilibrium. Heart rate, left ventricular developed pressure (LVDP), left ventricular end-diastolic pressure (LVEDP), and the maximum rate of increase or decrease of left ventricular pressure (± dp/dt max) were recorded. Infarct size was determined using triphenyltetrazolium chloride (TTC) staining. Myocardial TUNEL staining was used as the in situ cell death detection method and the percentage of TUNEL-positive nuclei to all nuclei counted was used as the apoptotic index. The expression of STAT3, bcl-2 and bax was determined by Western blotting. After reperfusion, compared to the I/R group, H2S significantly improved functional recovery and decreased infarct size (23.3 ± 3.8 vs 41.2 ± 4.7%, P < 0.05) and apoptotic index (22.1 ± 3.6 vs 43.0 ± 4.8%, P < 0.05). However, H2S-mediated protection was abolished by AG-490, the JAK2 inhibitor. In conclusion, H2S postconditioning effectively protects isolated I/R rat hearts via activation of the JAK2/STAT3 signaling pathway.

Plasmatic ADAMTS-13 metalloprotease and von Willebrand factor in children with cyanotic congenital heart disease

Changes in plasma von Willebrand factor concentration (VWF:Ag) and ADAMTS-13 activity (the metalloprotease that cleaves VWF physiologically) have been reported in several cardiovascular disorders with prognostic implications. We therefore determined the level of these proteins in the plasma of children with cyanotic congenital heart disease (CCHD) undergoing surgical treatment. Forty-eight children were enrolled (age 0.83 to 7.58 years). Measurements were performed at baseline and 48 h after surgery. ELISA, collagen-binding assays and Western blotting were used to estimate antigenic and biological activities, and proteolysis of VWF multimers. Preoperatively, VWF:Ag and ADAMTS-13 activity were decreased (65 and 71% of normal levels considered as 113 (105-129) U/dL and 91 ± 24% respectively, P < 0.003) and correlated (r = 0.39, P = 0.0064). High molecular weight VWF multimers were not related, suggesting an interaction of VWF with cell membranes, followed by proteolytic cleavage. A low preoperative ADAMTS-13 activity, a longer activated partial thromboplastin time and the need for cardiopulmonary bypass correlated with postoperative bleeding (P < 0.05). Postoperatively, ADAMTS-13 activity increased but less extensively than VWF:Ag (respectively, 2.23 and 2.83 times baseline, P < 0.0001), resulting in an increased VWF:Ag/ADAMTS-13 activity ratio (1.20 to 1.54, respectively, pre- and postoperative median values, P = 0.0029). ADAMTS-13 consumption was further confirmed by decreased ADAMTS-13 antigenic concentration (0.91 ± 0.30 to 0.70 ± 0.25 µg/mL, P < 0.0001) and persistent proteolysis of VWF multimers. We conclude that, in pediatric CCHD, changes in circulating ADAMTS-13 suggest enzyme consumption, associated with abnormal structure and function of VWF.

A phthalide derivative isolated from endophytic fungiPestalotiopsis photiniae induces G1 cell cycle arrest and apoptosis in human HeLa cells

MP [4-(3′,3′-dimethylallyloxy)-5-methyl-6-methoxyphthalide] was obtained from liquid culture of Pestalotiopsis photiniaeisolated from the Chinese Podocarpaceae plant Podocarpus macrophyllus. MP significantly inhibited the proliferation of HeLa tumor cell lines. After treatment with MP, characteristic apoptotic features such as DNA fragmentation and chromatin condensation were observed in DAPI-stained HeLa cells. Flow cytometry showed that MP induced G1 cell cycle arrest and apoptosis in a dose-dependent manner. Western blotting and real-time reverse transcription-polymerase chain reaction were used to investigate protein and mRNA expression. MP caused significant cell cycle arrest by upregulating the cyclin-dependent kinase inhibitor p27KIP1 protein and p21CIP1 mRNA levels in HeLa cells. The expression of p73 protein was increased after treatment with various MP concentrations. mRNA expression of the cell cycle-related genes, p21CIP1, p16INK4a and Gadd45α, was significantly upregulated and mRNA levels demonstrated significantly increased translation ofp73, JunB, FKHR, andBim. The results indicate that MP may be a potential treatment for cervical cancer.

Quercetin postconditioning attenuates myocardial ischemia/reperfusion injury in rats through the PI3K/Akt pathway

Quercetin (Que), a plant-derived flavonoid, has multiple benefical actions on the cardiovascular system. The current study investigated whether Que postconditioning has any protective effects on myocardial ischemia/reperfusion (I/R) injury in vivo and its potential cardioprotective mechanisms. Male Sprague-Dawley rats were randomly allocated to 5 groups (20 animals/group): sham, I/R, Que postconditioning, Que+LY294002 [a phosphatidylinositol 3-kinase (PI3K)/Akt signaling pathway inhibitor], and LY294002+I/R. I/R was produced by 30-min coronary occlusion followed by 2-h reperfusion. At the end of reperfusion, myocardial infarct size and biochemical changes were compared. Apoptosis was evaluated by both TUNEL staining and measurement of activated caspase-3 immunoreactivity. The phosphorylation of Akt and protein expression of Bcl-2 and Bax were determined by Western blotting. Que postconditioning significantly reduced infarct size and serum levels of creatine kinase and lactate dehydrogenase compared with the I/R group (all P<0.05). Apoptotic cardiomyocytes and caspase-3 immunoreactivity were also suppressed in the Que postconditioning group compared with the I/R group (both P<0.05). Akt phosphorylation and Bcl-2 expression increased after Que postconditioning, but Bax expression decreased. These effects were inhibited by LY294002. The data indicate that Que postconditioning can induce cardioprotection by activating the PI3K/Akt signaling pathway and modulating the expression of Bcl-2 and Bax proteins.

VEGF receptor expression decreases during lung development in congenital diaphragmatic hernia induced by nitrofen

Changes in vascular endothelial growth factor (VEGF) in pulmonary vessels have been described in congenital diaphragmatic hernia (CDH) and may contribute to the development of pulmonary hypoplasia and hypertension; however, how the expression of VEGF receptors changes during fetal lung development in CDH is not understood. The aim of this study was to compare morphological evolution with expression of VEGF receptors, VEGFR1 (Flt-1) and VEGFR2 (Flk-1), in pseudoglandular, canalicular, and saccular stages of lung development in normal rat fetuses and in fetuses with CDH. Pregnant rats were divided into four groups (n=20 fetuses each) of four different gestational days (GD) 18.5, 19.5, 20.5, 21.5: external control (EC), exposed to olive oil (OO), exposed to 100 mg nitrofen, by gavage, without CDH (N-), and exposed to nitrofen with CDH (CDH) on GD 9.5 (term=22 days). The morphological variables studied were: body weight (BW), total lung weight (TLW), left lung weight, TLW/BW ratio, total lung volume, and left lung volume. The histometric variables studied were: left lung parenchymal area density and left lung parenchymal volume. VEGFR1 and VEGFR2 expression were determined by Western blotting. The data were analyzed using analysis of variance with the Tukey-Kramer post hoc test. CDH frequency was 37% (80/216). All the morphological and histometric variables were reduced in the N- and CDH groups compared with the controls, and reductions were more pronounced in the CDH group (P<0.05) and more evident on GD 20.5 and GD 21.5. Similar results were observed for VEGFR1 and VEGFR2 expression. We conclude that N- and CDH fetuses showed primary pulmonary hypoplasia, with a decrease in VEGFR1 and VEGFR2 expression.

Beneficial effects of Ginkgo biloba extract on insulin signaling cascade, dyslipidemia, and body adiposity of diet-induced obese rats

Ginkgo biloba extract (GbE) has been indicated as an efficient medicine for the treatment of diabetes mellitus type 2. It remains unclear if its effects are due to an improvement of the insulin signaling cascade, especially in obese subjects. The aim of the present study was to evaluate the effect of GbE on insulin tolerance, food intake, body adiposity, lipid profile, fasting insulin, and muscle levels of insulin receptor substrate 1 (IRS-1), protein tyrosine phosphatase 1B (PTP-1B), and protein kinase B (Akt), as well as Akt phosphorylation, in diet-induced obese rats. Rats were fed with a high-fat diet (HFD) or a normal fat diet (NFD) for 8 weeks. After that, the HFD group was divided into two groups: rats gavaged with a saline vehicle (HFD+V), and rats gavaged with 500 mg/kg of GbE diluted in the saline vehicle (HFD+Gb). NFD rats were gavaged with the saline vehicle only. At the end of the treatment, the rats were anesthetized, insulin was injected into the portal vein, and after 90s, the gastrocnemius muscle was removed. The quantification of IRS-1, Akt, and Akt phosphorylation was performed using Western blotting. Serum levels of fasting insulin and glucose, triacylglycerols and total cholesterol, and LDL and HDL fractions were measured. An insulin tolerance test was also performed. Ingestion of a hyperlipidic diet promoted loss of insulin sensitivity and also resulted in a significant increase in body adiposity, plasma triacylglycerol, and glucose levels. In addition, GbE treatment significantly reduced food intake and body adiposity while it protected against hyperglycemia and dyslipidemia in diet-induced obesity rats. It also enhanced insulin sensitivity in comparison to HFD+V rats, while it restored insulin-induced Akt phosphorylation, increased IRS-1, and reduced PTP-1B levels in gastrocnemius muscle. The present findings suggest that G. biloba might be efficient in preventing and treating obesity-induced insulin signaling impairment.

DNA methylation regulates expression of VEGF-C, and S-adenosylmethionine is effective for VEGF-C methylation and for inhibiting cancer growth

DNA hypomethylation may activate oncogene transcription, thus promoting carcinogenesis and tumor development. S-adenosylmethionine (SAM) is a methyl donor in numerous methylation reactions and acts as an inhibitor of intracellular demethylase activity, which results in hypermethylation of DNA. The main objectives of this study were to determine whether DNA hypomethylation correlated with vascular endothelial growth factor-C (VEGF-C) expression, and the effect of SAM on VEGF-C methylation and gastric cancer growth inhibition. VEGF-C expression was assayed by Western blotting and RT-qPCR in gastric cancer cells, and by immunohistochemistry in tumor xenografts. VEGF-C methylation was assayed by bisulfite DNA sequencing. The effect of SAM on cell apoptosis was assayed by flow cytometry analyses and its effect on cancer growth was assessed in nude mice. The VEGF-C promoters of MGC-803, BGC-823, and SGC-7901 gastric cancer cells, which normally express VEGF-C, were nearly unmethylated. After SAM treatment, the VEGF-C promoters in these cells were highly methylated and VEGF-C expression was downregulated. SAM also significantly inhibited tumor growthin vitro and in vivo. DNA methylation regulates expression of VEGF-C. SAM can effectively induce VEGF-C methylation, reduce the expression of VEGF-C, and inhibit tumor growth. SAM has potential as a drug therapy to silence oncogenes and block the progression of gastric cancer.

Propofol pretreatment attenuates lipopolysaccharide-induced acute lung injury in rats by activating the phosphoinositide-3-kinase/Akt pathway

The aim of this study was to investigate the effect of propofol pretreatment on lipopolysaccharide (LPS)-induced acute lung injury (ALI) and the role of the phosphoinositide-3-kinase/protein kinase B (PI3K/Akt) pathway in this procedure. Survival was determined 48 h after LPS injection. At 1 h after LPS challenge, the lung wet- to dry-weight ratio was examined, and concentrations of protein, tumor necrosis factor-α (TNF-α), and interleukin-6 (IL-6) in bronchoalveolar lavage fluid (BALF) were determined using the bicinchoninic acid method or ELISA. Lung injury was assayed via lung histological examination. PI3K and p-Akt expression levels in the lung tissue were determined by Western blotting. Propofol pretreatment prolonged survival, decreased the concentrations of protein, TNF-α, and IL-6 in BALF, attenuated ALI, and increased PI3K and p-Akt expression in the lung tissue of LPS-challenged rats, whereas treatment with wortmannin, a PI3K/Akt pathway specific inhibitor, blunted this effect. Our study indicates that propofol pretreatment attenuated LPS-induced ALI, partly by activation of the PI3K/Akt pathway.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Plasma levels and placental expression of vaspin in pregnant women with diabetes mellitus

The present study aimed to investigate visceral adipose tissue-specific serpin (vaspin) concentrations in serum and term placentas and relate these values to insulin resistance and lipid parameters in women with gestational diabetes mellitus (GDM). A total of 30 GDM subjects and 27 age-matched pregnant women with normal glucose tolerance (NGT, control) were included. Serum glucose, glycated hemoglobin (HbA1c), lipid profile, insulin, and vaspin were measured at the end of pregnancy, and homeostasis model of assessment-insulin resistance (HOMA-IR) values were calculated. Vaspin mRNA and protein levels in placentas were measured by real-time fluorescence quantitative reverse transcription polymerase chain reaction (RT-qPCR) and Western blotting, respectively. Serum vaspin levels were significantly lower in the GDM group than in controls (0.49±0.24 vs 0.83±0.27 ng/mL, respectively; P<0.01). Three days after delivery, serum vaspin levels were significantly decreased in subjects with GDM (0.36±0.13 vs0.49±0.24 ng/mL, P<0.01). However, in the GDM group, serum vaspin levels were not correlated with the parameters evaluated. In contrast, in the control group, serum vaspin levels were positively correlated with triglycerides (TG; r=0.45, P=0.02) and very low-density lipoprotein cholesterol (VLDL-C; r=0.42, P=0.03). Placental mRNA vaspin (0.60±0.32 vs0.68±0.32, P=0.46) and protein (0.30±0.08 vs0.39±0.26; P=0.33) levels in the GDM group did not differ significantly from those in the control group, but were negatively correlated with neonatal birth weight in the GDM group (r=-0.48, P=0.03; r=-0.88; P<0.01). Our findings indicated that vaspin may be an important adipokine involved in carbohydrate and lipid metabolism and may also play a role in fetal development.

Effects of propofol on lipopolysaccharide-induced expression and release of HMGB1 in macrophages

This study aimed to determine the effects of different concentrations of propofol (2,6-diisopropylphenol) on lipopolysaccharide (LPS)-induced expression and release of high-mobility group box 1 protein (HMGB1) in mouse macrophages. Mouse macrophage cell line RAW264.7 cells were randomly divided into 5 treatment groups. Expression levels of HMGB1 mRNA were detected using RT-PCR, and cell culture supernatant HMGB1 protein levels were detected using enzyme-linked immunosorbent assay (ELISA). Translocation of HMGB1 from the nucleus to the cytoplasm in macrophages was observed by Western blotting and activity of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) in the nucleus was detected using ELISA. HMGB1 mRNA expression levels increased significantly in the cell culture supernatant and in cells after 24 h of stimulating RAW264.7 cells with LPS (500 ng/mL). However, HMGB1 mRNA expression levels in the P2 and P3 groups, which received 500 ng/mL LPS with 25 or 50 μmol/mL propofol, respectively, were significantly lower than those in the group receiving LPS stimulation (P<0.05). After stimulation by LPS, HMGB1 protein levels were reduced significantly in the nucleus but were increased in the cytoplasm (P<0.05). Simultaneously, the activity of NF-κB was enhanced significantly (P<0.05). After propofol intervention, HMGB1 translocation from the nucleus to the cytoplasm and NF-κB activity were inhibited significantly (each P<0.05). Thus, propofol can inhibit the LPS-induced expression and release of HMGB1 by inhibiting HMGB1 translocation and NF-κB activity in RAW264.7 cells, suggesting propofol may be protective in patients with sepsis.

Propofol inhibits burn injury-induced hyperpermeability through an apoptotic signal pathway in microvascular endothelial cells

Recent studies have revealed that an intrinsic apoptotic signaling cascade is involved in vascular hyperpermeability and endothelial barrier dysfunction. Propofol (2,6-diisopropylphenol) has also been reported to inhibit apoptotic signaling by regulating mitochondrial permeability transition pore (mPTP) opening and caspase-3 activation. Here, we investigated whether propofol could alleviate burn serum-induced endothelial hyperpermeability through the inhibition of the intrinsic apoptotic signaling cascade. Rat lung microvascular endothelial cells (RLMVECs) were pretreated with propofol at various concentrations, followed by stimulation with burn serum, obtained from burn-injury rats. Monolayer permeability was determined by transendothelial electrical resistance. Mitochondrial release of cytochrome C was measured by ELISA. Bax and Bcl-2 expression and mitochondrial release of second mitochondrial-derived activator of caspases (smac) were detected by Western blotting. Caspase-3 activity was assessed by fluorometric assay; mitochondrial membrane potential (Δψm) was determined with JC-1 (a potential-sensitive fluorescent dye). Intracellular ATP content was assayed using a commercial kit, and reactive oxygen species (ROS) were measured by dichlorodihydrofluorescein diacetate (DCFH-DA). Burn serum significantly increased monolayer permeability (P<0.05), and this effect could be inhibited by propofol (P<0.05). Compared with a sham treatment group, intrinsic apoptotic signaling activation - indicated by Bax overexpression, Bcl-2 downregulation, Δψm reduction, decreased intracellular ATP level, increased cytosolic cytochrome C and smac, and caspase-3 activation - was observed in the vehicle group. Propofol not only attenuated these alterations (P<0.05 for all), but also significantly decreased burn-induced ROS production (P<0.05). Propofol attenuated burn-induced RLMVEC monolayer hyperpermeability by regulating the intrinsic apoptotic signaling pathway.

The effects of 6-gingerol on proliferation, differentiation, and maturation of osteoblast-like MG-63 cells

We investigated whether 6-gingerol affects the maturation and proliferation of osteoblast-like MG63 cells in vitro. Osteoblast-like MG63 cells were treated with 6-gingerol under control conditions, and experimental inflammation was induced by tumor necrosis factor-α (TNF-α). Expression of different osteogenic markers and cytokines was analyzed by real-time PCR, Western blotting, and enzyme-linked immunosorbent assay. In addition, alkaline phosphatase (ALP) enzyme activity and biomineralization as markers for differentiation were measured. Treatment with 6-gingerol resulted in insignificant effects on the proliferation rate. 6-Gingerol induced the differentiation of osteoblast-like cells with increased transcription levels of osteogenic markers, upregulated ALP enzyme activity, and enhanced mineralized nodule formation. Stimulation with TNF-α led to enhanced interleukin-6 and nuclear factor-κB expression and downregulated markers of osteoblastic differentiation. 6-Gingerol reduced the degree of inflammation in TNF-α-treated MG-63 cells. In conclusion, 6-gingerol stimulated osteoblast differentiation in normal physiological and inflammatory settings, and therefore, 6-gingerol represents a promising agent for treating osteoporosis or bone inflammation.

Overexpression of Salmonella enterica serovar Typhi recA gene confers fluoroquinolone resistance in Escherichia coli DH5α

A spontaneous fluoroquinolone-resistant mutant (STM1) was isolated from its parent Salmonella enterica serovar Typhi (S. Typhi) clinical isolate. Unlike its parent isolate, this mutant has selective resistance to fluoroquinolones without any change in its sensitivity to various other antibiotics. DNA gyrase assays revealed that the fluoroquinolone resistance phenotype of the STM1 mutant did not result from alteration of the fluoroquinolone sensitivity of the DNA gyrase isolated from it. To study the mechanism of fluoroquinolone resistance, a genomic library from the STM1 mutant was constructed in Escherichia coli DH5α and two recombinant plasmids were obtained. Only one of these plasmids (STM1-A) conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. The chromosomal insert from STM1-A, digested with EcoRI and HindIII restriction endonucleases, produced two DNA fragments and these were cloned separately into pUC19 thereby generating two new plasmids, STM1-A1 and STM1-A2. Only STM1-A1 conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. Sequence and subcloning analyses of STM1-A1 showed the presence of an intact RecA open reading frame. Unlike that of the wild-type E. coli DH5α, protein analysis of a crude STM1-A1 extract showed overexpression of a 40 kDa protein. Western blotting confirmed the 40 kDa protein band to be RecA. When a RecA PCR product was cloned into pGEM-T and introduced into E. coli DH5α, the STM1-A11 subclone retained fluoroquinolone resistance. These results suggest that overexpression of RecA causes selective fluoroquinolone resistance in E. coli DH5α.

Hormonal therapy with estradiol and drospirenone improves endothelium-dependent vasodilation in the coronary bed of ovariectomized spontaneously hypertensive rats

Drospirenone (DRSP) is a progestin with anti-aldosterone properties and it reduces blood pressure in hypertensive women. However, the effects of DRSP on endothelium-dependent coronary vasodilation have not been evaluated. This study investigated the effects of combined therapy with estrogen (E2) and DRSP on endothelium-dependent vasodilation of the coronary bed of ovariectomized (OVX) spontaneously hypertensive rats. Female spontaneously hypertensive rats (n=87) at 12 weeks of age were randomly divided into sham operated (Sham), OVX, OVX treated with E2 (E2), and OVX treated with E2 and DRSP (E2+DRSP) groups. Hemodynamic parameters were directly evaluated by catheter insertion into the femoral artery. Endothelium-dependent vasodilation in response to bradykinin in the coronary arterial bed was assessed using isolated hearts according to a modified Langendorff method. Coronary protein expression of endothelial nitric oxide synthase and estrogen receptor alpha (ER-α) was assessed by Western blotting. Histological slices of coronary arteries were stained with hematoxylin and eosin, and morphometric parameters were analyzed. Oxidative stress was assessed in situ by dihydroethidium fluorescence. Ovariectomy increased systolic blood pressure, which was only prevented by E2+DRSP treatment. Estrogen deficiency caused endothelial dysfunction, which was prevented by both treatments. However, the vasodilator response in the E2+DRSP group was significantly higher at the three highest concentrations compared with the OVX group. Reduced ER-α expression in OVX rats was restored by both treatments. Morphometric parameters and oxidative stress were augmented by OVX and reduced by E2 and E2+DRSP treatments. Hormonal therapy with E2 and DRSP may be an important therapeutic option in the prevention of coronary heart disease in hypertensive post-menopausal women.