Evaluation of renal function in sickle cell disease patients in Brazil

The objective of this study was to investigate renal function in a cohort of 98 patients with sickle cell disease (SCD) followed up at a tertiary hospital in Brazil. Clinical and laboratory characteristics at the time of the most recent medical examination were analyzed. Renal function was evaluated by the estimation of glomerular filtration rate (GFR) by the criteria of the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI). We compared patients with normal GFR to patients with decreased GFR (<60 mL·min-1·(1.73 m²)-1) and hyperfiltration (>120 mL·min-1·(1.73 m²)-1). Comparison between patients according to the use of hydroxyurea and comparison of clinical and laboratory parameters according to GFR were also carried out. Average patient age was 33.8 ± 13.3 years (range 19-67 years), and 57 (58.1%) patients were females. The comparison of patients according to GFR showed that patients with decreased GFR (<60 mL·min-1·(1.73 m²)-1) were older, had lower levels of hematocrit, hemoglobin and platelets and higher levels of urea and creatinine. Independent risk factors for decreased GFR were advanced age (OR = 21.6, P < 0.0001) and anemia (OR = 39.6, P < 0.0001). Patients with glomerular hyperfiltration tended to be younger, had higher levels of hematocrit, hemoglobin and platelets and lower levels of urea and creatinine, with less frequent urinary abnormalities. Hydroxyurea, at the dosage of 500-1000 mg/day, was being administered to 28.5% of the patients, and there was no significant difference regarding renal function between the two groups. Further studies are required to establish the best therapeutic approach to renal abnormalities in SCD.

Effect of eccentric training on mitochondrial function and oxidative stress in the skeletal muscle of rats

The objective of the present study was to investigate the effects of eccentric training on the activity of mitochondrial respiratory chain enzymes, oxidative stress, muscle damage, and inflammation of skeletal muscle. Eighteen male mice (CF1) weighing 30-35 g were randomly divided into 3 groups (N = 6): untrained, trained eccentric running (16°; TER), and trained running (0°) (TR), and were submitted to an 8-week training program. TER increased muscle oxidative capacity (succinate dehydrogenase and complexes I and II) in a manner similar to TR, and TER did not decrease oxidative damage (xylenol and creatine phosphate) but increased antioxidant enzyme activity (superoxide dismutase and catalase) similar to TR. Muscle damage (creatine kinase) and inflammation (myeloperoxidase) were not reduced by TER. In conclusion, we suggest that TER improves mitochondrial function but does not reduce oxidative stress, muscle damage, or inflammation induced by eccentric contractions.

Cardiorespiratory fitness, pulmonary function and C-reactive protein levels in nonsmoking individuals with diabetes

The objective of this study was to evaluate cardiorespiratory fitness and pulmonary function and the relationship with metabolic variables and C-reactive protein (CRP) plasma levels in individuals with diabetes mellitus (DM). Nineteen men with diabetes and 19 age- and gender-matched control subjects were studied. All individuals were given incremental cardiopulmonary exercise and pulmonary function tests. In the exercise test, maximal workload (158.3±22.3vs 135.1±25.2, P=0.005), peak heart rate (HRpeak: 149±12 vs 139±10, P=0.009), peak oxygen uptake (VO2peak: 24.2±3.2 vs18.9±2.8, P<0.001), and anaerobic threshold (VO2VT: 14.1±3.4 vs 12.2±2.2, P=0.04) were significantly lower in individuals with diabetes than in control subjects. Pulmonary function test parameters, blood pressure, lipid profile (triglycerides, HDL, LDL, and total cholesterol), and CRP plasma levels were not different in control subjects and individuals with DM. No correlations were observed between hemoglobin A1C (HbA1c), CRP and pulmonary function test and cardiopulmonary exercise test performance. In conclusion, the results demonstrate that nonsmoking individuals with DM have decreased cardiorespiratory fitness that is not correlated with resting pulmonary function parameters, HbA1c, and CRP plasma levels.

Serotonin regulates osteoblast proliferation and function in vitro

The monoamine serotonin (5-hydroxytryptamine, 5-HT), a well-known neurotransmitter, also has important functions outside the central nervous system. The objective of this study was to investigate the role of 5-HT in the proliferation, differentiation, and function of osteoblasts in vitro. We treated rat primary calvarial osteoblasts with various concentrations of 5-HT (1 nM to 10 µM) and assessed the rate of osteoblast proliferation, expression levels of osteoblast-specific proteins and genes, and the ability to form mineralized nodules. Next, we detected which 5-HT receptor subtypes were expressed in rat osteoblasts at different stages of osteoblast differentiation. We found that 5-HT could inhibit osteoblast proliferation, differentiation, and mineralization at low concentrations, but this inhibitory effect was mitigated at relatively high concentrations. Six of the 5-HT receptor subtypes (5-HT1A, 5-HT1B, 5-HT1D, 5-HT2A, 5-HT2B, and 5-HT2C) were found to exist in rat osteoblasts. Of these, 5-HT2A and 5-HT1Breceptors had the highest expression levels, at both early and late stages of differentiation. Our results indicated that 5-HT can regulate osteoblast proliferation and function in vitro.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Correlation between heart rate variability and pulmonary function adjusted by confounding factors in healthy adults

The autonomic nervous system maintains homeostasis, which is the state of balance in the body. That balance can be determined simply and noninvasively by evaluating heart rate variability (HRV). However, independently of autonomic control of the heart, HRV can be influenced by other factors, such as respiratory parameters. Little is known about the relationship between HRV and spirometric indices. In this study, our objective was to determine whether HRV correlates with spirometric indices in adults without cardiopulmonary disease, considering the main confounders (e.g., smoking and physical inactivity). In a sample of 119 asymptomatic adults (age 20-80 years), we evaluated forced vital capacity (FVC) and forced expiratory volume in 1 s (FEV1). We evaluated resting HRV indices within a 5-min window in the middle of a 10-min recording period, thereafter analyzing time and frequency domains. To evaluate daily physical activity, we instructed participants to use a triaxial accelerometer for 7 days. Physical inactivity was defined as <150 min/week of moderate to intense physical activity. We found that FVC and FEV1, respectively, correlated significantly with the following aspects of the RR interval: standard deviation of the RR intervals (r =0.31 and 0.35), low-frequency component (r =0.38 and 0.40), and Poincaré plot SD2 (r =0.34 and 0.36). Multivariate regression analysis, adjusted for age, sex, smoking, physical inactivity, and cardiovascular risk, identified the SD2 and dyslipidemia as independent predictors of FVC and FEV1 (R2=0.125 and 0.180, respectively, for both). We conclude that pulmonary function is influenced by autonomic control of cardiovascular function, independently of the main confounders.

Oxidative enzymes activity in sugarcane juice as a function of the planting system

In Brazil, the largest producer of sugarcane in the world, the industrial process transforms this crop into ethanol and/or granulated sugar. Some cultivars exhibit enzymatic browning in the extracted sugarcane juice at levels harmful to the manufacturing process of white granulated sugar. The objective of this study was to assess the effect of sugarcane straw used as soil coverage, the use of different planting systems, and treatments with hydrogel polymer on enzymatic activity. The cultivar RB 86 7515 was sampled for 8 months; the first sample was obtained by cutting the upper portion of the stalk at the internode, which was taken to the laboratory for determination of the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The soil coverage with different forms of straw as well as the planting systems did not change the enzymatic activity of polyphenoloxidase (PPO) and peroxidase (POD). The polyphenoloxidase (PPO) activity increased with the use of a polymer due to increased polyphenoloxidase (PPO) activity in the groove system. The enzymes studied showed changes in activity during the experimental period. The production of sugar at the end of the season (August to November) avoids the periods of highest enzymatic activity.

Evaluation of metabolic syndrome and associations with inflammation and graft function in renal transplant recipients

INTRODUCTION: Cardiovascular disease (CVD) is a major determinant of mortality in renal transplant recipients (RTR). Metabolic syndrome (MS) and chronic inflammation are currently considered non traditional risk factors for cardiovascular disease. This study evaluates the frequency of these conditions their associations with graft function. OBJECTIVE: To evaluate the prevalence of metabolic syndrome (MS) and inflammation and their associations with graft function in renal transplant recipients. METHODS: A cross-sectional study was carried out with 200 RTR. MS was defined by the NCEP-ATP III criteria. Inflammation was assessed by CRP levels. Renal function was assessed by GFR estimation using the MDRD equation. RESULTS: MS occurred in 71 patients (35.5%). Patients with MS had higher CPR and decreased GFR levels. Inflammation was present in 99 patients (49.5%). Mean waist perimeter, body mass index, triglycerides and serum total cholesterol were significantly higher in inflamed patients. An association between MS and inflammation was demonstrated, 48 (67.6%) patients with MS were inflamed and among those without MS the rate of inflamed patients was 39.5% (51 patients) (p < 0.001). A significantly higher percentage of patients with MS in the group of patients in chronic renal disease stages III and IV was observed. CONCLUSION: In RTR there is a significant association among MS and inflammation. MS is negatively associated with graft function. The clinical implications of these findings must be evaluated in longitudinal studies.

Histopathological analysis of pre-implantation donor kidney biopsies: association with graft survival and function in one year post-transplantation

Introduction: Pre-implantation kidney biopsy is a decision-making tool when considering the use of grafts from deceased donors with expanded criteria, implanting one or two kidneys and comparing this to post-transplantation biopsies. The role of histopathological alterations in kidney compartments as a prognostic factor in graft survival and function has had conflicting results. Objective: This study evaluated the prevalence of chronic alterations in pre-implant biopsies of kidney grafts and the association of findings with graft function and survival in one year post-transplant. Methods: 110 biopsies were analyzed between 2006 and 2009 at Santa Casa de Porto Alegre, including live donors, ideal deceased donors and those with expanded criteria. The score was computed according to criteria suggested by Remuzzi. The glomerular filtration rate (GFR) was calculated using the abbreviated MDRD formula. Results: No statistical difference was found in the survival of donors stratified according to Remuzzi criteria. The GFR was significantly associated with the total scores in the groups with mild and moderate alterations, and in the kidney compartments alone, by univariate analysis. The multivariate model found an association with the presence of arteriosclerosis, glomerulosclerosis, acute rejection and delayed graft function. Conclusion: Pre-transplant chronic kidney alterations did not influence the post-transplantation one-year graft survival, but arteriosclerosis and glomerulosclerosis is predictive of a worse GFR. Delayed graft function and acute rejection are independent prognostic factors.