65 resultados para Envelope theorem


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Peripheral glial cells consist of satellite, enteric glial, and Schwann cells. In dorsal root ganglia, besides pseudo-unipolar neurons, myelinated and nonmyelinated fibers, macrophages, and fibroblasts, satellite cells also constitute the resident components. Information on satellite cells is not abundant; however, they appear to provide mechanical and metabolic support for neurons by forming an envelope surrounding their cell bodies. Although there is a heterogeneous population of neurons in the dorsal root ganglia, satellite cells have been described to be a homogeneous group of perineuronal cells. Our objective was to characterize the ultrastructure, immunohistochemistry, and histochemistry of the satellite cells of the dorsal root ganglia of 17 adult 3-4-month-old Wistar rats of both genders. Ultrastructurally, the nuclei of some satellite cells are heterochromatic, whereas others are euchromatic, which may result from different amounts of nuclear activity. We observed positive immunoreactivity for S-100 and vimentin in the cytoplasm of satellite cells. The intensity of S-100 protein varied according to the size of the enveloped neuron. We also noted that vimentin expression assumed a ring-like pattern and was preferentially located in the cytoplasm around the areas stained for S-100. In addition, we observed nitric oxide synthase-positive small-sized neurons and negative large-sized neurons equal to that described in the literature. Satellite cells were also positive for NADPH-diaphorase, particularly those associated with small-sized neurons. We conclude that all satellite cells are not identical as previously thought because they have different patterns of glial marker expression and these differences may be correlated with the size and function of the neuron they envelope.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Hepatitis E virus (HEV) is classified within the family Hepeviridae, genus Hepevirus. HEV genotype 3 (Gt3) infections are endemic in pigs in Western Europe and in North and South America and cause zoonotic infections in humans. Several serological assays to detect HEV antibodies in pigs have been developed, at first mainly based on HEV genotype 1 (Gt1) antigens. To develop a sensitive HEV Gt3 ELISA, a recombinant baculovirus expression product of HEV Gt3 open reading frame-2 was produced and coated onto polystyrene ELISA plates. After incubation of porcine sera, bound HEV antibodies were detected with anti-porcine anti-IgG and anti-IgM conjugates. For primary estimation of sensitivity and specificity of the assay, sets of sera were used from pigs experimentally infected with HEV Gt3. For further validation of the assay and to set the cutoff value, a batch of 1100 pig sera was used. All pig sera were tested using the developed HEV Gt3 assay and two other serologic assays based on HEV Gt1 antigens. Since there is no gold standard available for HEV antibody testing, further validation and a definite setting of the cutoff of the developed HEV Gt3 assay were performed using a statistical approach based on Bayes' theorem. The developed and validated HEV antibody assay showed effective detection of HEV-specific antibodies. This assay can contribute to an improved detection of HEV antibodies and enable more reliable estimates of the prevalence of HEV Gt3 in swine in different regions.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The objective and originality of this paper lie in identifying Stiglitz's main theoretical contributions to Financial Economics and in briefly portraying the contemporary economic thought out of which these contributions emerged as well as in suggesting their connections with the subsequent economic thought. Grounded on a detailed analysis of Stiglitz's works on finance, his most important theoretical findings are singled out and gathered into four issues: (1) the conditions under which the Modigliani-Miller theorem is valid; (2) the inconsistency inherent to the efficient market hypothesis; (3) the microeconomic effects of asymmetrical information in financial markets; and (4) its real macroeconomic effects. In all of these topics, the focal point of Stiglitz's theoretical research is the unrealistic underpinnings on which the Arrow-Debreu competitive equilibrium model relies. It is also emphasised that this same perspective he coherently followed to construct a fully-fledged theoretical framework would be preserved in his empirical investigations, notably about developing countries, on which he has concentrated effort since the beginnings of the nineties.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In this paper we extend Kaldor’s Neo-Pasinetti theorem to the scope of budgetary interventions based on political orientations. First, we take into account a system of taxes and expenditures. Second, we introduce different reaction functions for public spending showing the political role of the State in Cambridge theory of distribution. It turns out that the validity of Kaldorian results depends on the political orientation adopted by government, which diminishes the range of application of the Neo-Pasinetti theorem.