94 resultados para Athletic horses.
Resumo:
"Mal de Cadeiras", an enzootic disease caused by Trypanosoma evansi, is one of the most important trypanosomiases in the Brazilian Pantanal region. The disease affects mainly horses, which are widely used in extensive cattle production, an activity of greatest economical significance for the region. The parasite also infects sylvan (coatis and capybaras) and domestic (dogs) animals, respectively considered wild and domestic reservoirs of T. evansi. For a better understanding of the interaction of T. evansi with its rodent host, we evaluated the differences in the specific antibody level patterns and in the parasitic peptides recognition patterns of experimentally infected Wistar rats. The rats experimentally infected with T. evansi isolates obtained from coatis, dogs and horses were submitted to indirect immunofluorescence test (IgM e IgG) and Western blotting. The serological titers for IgM and IgG ranged between 1:40 and 1:160. The most recognized polypeptide profiles were in a range of 17 and 74 kDa. Our data suggest that the humoral immune response in Wistar rats is not sufficient for granting an effective control of T. evansi infections.
Resumo:
This paper describes some morphological aspects of Cylicocyclus brevicapsulatus (Ihle, 1920) (Nematoda: Cyathostominae) from Equus caballus in Brazil. The worms were studied using an optical microscope (measurements and illustrations) and a scanning electron microscope for a more detailed examination of the external morphology. The buccal capsule is very short, with a very thin wall, and the dorsal gutter is absent. Other morphological aspects are described including measurement of the spicules and gubernaculum.
Resumo:
We present the results of a study on myiasis in Panama during the first years of a Cochliomyia hominivorax eradication program (1998-2005), with the aim of investigating the behavior of the flies that produce myiasis in animals and human beings. The hosts that registered positive for myiasis were cattle (46.4%), dogs (15.3%), humans (14.7%), birds (12%), pigs (6%), horses (4%), and sheep (1%). Six fly species caused myiasis: Dermatobia hominis (58%), Phaenicia spp. (20%), Cochliomyia macellaria (19%), Chrysomya rufifacies (0.4%), and maggots of unidentified species belonging to the Sarcophagidae (3%) and Muscidae (0.3%). With the Dubois index, was no evidence that the absence of C. hominivorax allowed an increase in the cases of facultative myiasis.
Resumo:
St. Louis encephalitis virus (SLEV) and West Nile virus (WNV) present ecological and antigenic similarities and are responsible for serious human diseases. In addition, WNV is a significant pathogen in terms of equine health. The purpose of our study was to analyse the seroprevalence of SLEV and WNV in equine sera collected in Santa Fe Province, Argentina. The seroprevalence determined using the plaque reduction neutralisation test was 12.2% for SLEV, 16.2% for WNV and 48.6% for a combination of both viruses. These results provide evidence of the co-circulation of SLEV and WNV in equines in Santa Fe.
Resumo:
Adult ticks of the species Amblyomma parvum were collected from the vegetation in the Pantanal biome (state of Mato Grosso do Sul) and from horses in the Cerrado biome (state of Piauí) in Brazil. The ticks were individually tested for rickettsial infection via polymerase chain reaction (PCR) targeting three rickettsial genes, gltA, ompA and ompB. Overall, 63.5% (40/63) and 66.7% (2/3) of A. parvum ticks from Pantanal and Cerrado, respectively, contained rickettsial DNA, which were all confirmed by DNA sequencing to be 100% identical to the corresponding fragments of the gltA, ompA and ompB genes of Candidatus Rickettsia andeanae. This report is the first to describe Ca. R. andeanae in Brazil.
Resumo:
GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5)fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.
Resumo:
Rhodococcus equi is a facultative intracellular pathogen associated with bronchopneumonia, mesenteric lymphadenitis and enterocolitis in foals. Although R. equi is likely to be found in every horse-breeding farm, the clinical disease is unrecognized in most of them. Capsule components, equi factor, micolic acid and some products encoded by the large 85-90Kb plasmid were described as virulence factors. However, the pathogenesis of R. equi infections and the sensibility of foals are not completely understood. The aim of this study was evaluate the virulence of R. equi isolated from human, horses and environment for mices. Nine strains carrying the 85-90Kb plasmid isolated from foal clinical specimens, one from immunodeficient human patient and six plasmidless strains (four isolated from feces, one from pasture and one from immunodeficient human patient) were inoculated in cyclophosphamide immunossuppressed mice. The pathological changes and viability of R. equi cells in the liver of mice was verified after the 3rd, 6th an 10th day after inoculation for horse and environmental isolates and for R. equi isolates from human patients on the 1st, 3rd and 6th day. During the necropsy procedures, infiltrate of macrophages and pyogranulomatous lesions were detected after the sixth pos-inoculation day in the liver and spleen. In horse isolates, only plasmid positive strains were virulent, but in human isolates both strains (plasmid positive e plasmid negative) were virulent. Both groups of the immunossupressed mice inoculated with R. equi isolated from environment showed pathological changes. All R. equi strains were unable to kill non imunossuppressed mice.
Resumo:
Ten outbreaks of anthrax occurred in cattle from 1978 to 2006 in southern Brazil, in 5 municipalities on the border with Uruguay, a country where the disease is frequent. The 10 outbreaks represented 0.2% of all bovine specimens received during the period by the Regional Diagnostic Laboratory of the Federal University of Pelotas, causing 267 deaths in a risk population of 6,605 head. The disease affected young and adult cattle mainly during summer. Only one farmer reported that sheep and horses were also affected. Clinically the peracute form was more frequent, but in some outbreaks the acute form with a clinical manifestation period of 6-48 hours was also observed. The source of infection was not established; but the reduced rainfall, associated with low, flat, flooded lands used for agriculture followed by animal grazing after harvest was probably related to the disease occurrence. Annual vaccination is an efficient way to prevent the disease.
Resumo:
Different species of Panicum, including P. dichotomiflorum,have been reported as a cause of photosensitization in sheep, horses, cattle and goats. An outbreak of hepatogenous photosensitization occurred in 3 flocks of hair sheep in the Brazilian semiarid region. Eighty one out of 365 sheep were affected and 39 died. The main affected animals were nursing lambs and sheep younger than one year old. Donkeys, goats and cattle grazing in the same pasture were not affected. Clinical signs were edema of the head, followed by dermatitis, mainly in the face, ears, and croup, ocular discharge, corneal opacity with blindness, and redness of the coronary band and hoof. At necropsy of one affected lamb the liver was yellowish. Upon histologic examination scattered necrotic hepatocytes were observed in the liver and focal areas of necrosis of myocytes appeared in the heart. Samples of P. dicotomiflorum were analyzed by TLC and those containing saponins were isolated by HPLC using RP-C18 column and eluted with a mixture of MeOH and H2O. The isolated compounds were submitted to ¹H and 13C NMR spectroscopy. Reactions were positive to furostanol saponins with the same Rf of the standard protodioscin (0.21) and methylprotodioscin (0.32). The spectroscopic results indicated a mixture of (25R)- and (25S)-protodioscin isomers in a proportion of 3:1, and methylprotodioscin.
Resumo:
Twenty-nine stud farms were selected in the Medium Paraíba region of the Rio de Janeiro state, Brazil. After an interview with the person responsible for the animals, faecal samples were collected from mares and analyzed via the EPG technique, faecal cultures, Sedimentation-centrifugo-flotation, and modified Ueno and Baermann techniques. The prevalence of helminths in the mares and in the stud farms was calculated. The stocking rates of pasture, change of horse bedding, absence of pasture rotation, absence of technology in the property, and less frequent treatment of the animals were associated with a greater prevalence of helminths, showing that these variables must be considered in equine control programs. The intensity of the parasitism was also associated with the stocking rate of pasture, absence of dunghill, presence of the animals only in paddocks, lack of technology in the property, less frequent treatment of the animals, and absence of the use of rotation regarding the anthelmintic class.
Resumo:
In August 2007 an outbreak of neurological disease and sudden death in Arabian horses occurred in a farm located in Coronel Rosales County, Buenos Aires Province, Argentina. The animals were on a pasture of native grasses and supplemented ad libitum with corn kernels and wheat bran. Three horses were observed having acute neurologic signs including blindness, four leg ataxia, hyperexcitability, aimless walking and circling, followed by death in two of them. Four other horses were found dead overnight without a history of neurologic signs. The morbidity, mortality and lethality rates were 11.6%, 10% and 85.7%, respectively. Grossly, the brain showed focal areas of hemorrhage, brown-yellow discoloration and softening of the sub-cortical white matter. The microscopic brain lesions consisted of extensive areas of malacia within the white matter of the cerebral hemispheres, brainstem and cerebellum, characterized by rarefaction of the white matter with cavitations filled with proteinaceous edema, multifocal hemorrhages and mild infiltration by neutrophils, and rare eosinophils. Swollen glial cells with abundant eosinophilic cytoplasm, distinct cell borders, intracytoplasmic deeply eosinophilic globules and eccentric, hyperchromatic, occasionally pyknotic nucleus were present throughout the areas of rarefaction hemorrhage, edema and necrosis. The feed supplements contained 12,490µg/kg of fumonisin B1 and 5,251µg/ kg of fumonisin B2. This is the first reported outbreak of ELEM associated with consumption of feed supplements containing high concentrations of fumonisins in Argentina.
Resumo:
Conventional PCR (PCRTeq) for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc) for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq) for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128), but did not differ significantly from the M/PCRTeq-Bc (1:64). In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780) and moderate agreement with N/PCR-Teq (k = 0.562) and M/PCRTeq-Bc (k = 0.488). PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05), and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05). PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.
Resumo:
The aim of this study was to determine the prevalence of anti-Leptospira spp. antibodies and the risk factors for Leptospira spp. infection in breeding cattle herds in the south central region of Paraná state. It was based on the statistic delineation/serological samples and information regarding the selected farms employed in the study of bovine brucellosis for Paraná state in the context of National Program for Control and Eradication of Brucellosis and Tuberculosis. A total of 1.880 females aged >24 months from 274 non vaccinated herds were studied. Serum samples were tested for antibodies against Leptospira spp. using microscopic agglutination test (MAT) with 22 Leptospira serovars. The epidemiological questionnaire was applied on all the selected farms and aimed to obtain epidemiological data. Hundred eighty one of 274 herds were positive for Leptospira spp./presenting prevalence of positive herds of 66.06% (IC95%=60.12-71,65%). Presence of >43 cattle (OR=3.120; IC=1.418-6.867)/animal purchase (OR=2.010; IC=1.154-3.500)/rent of pastures (OR=2.925; IC=1.060-8.068) and presence of maternity paddock (OR=1.981; IC=1,068-3,676) were identified as risk factors for leptospirosis due to any serovar in the multivariate logistic regression. Risk factors for leptospirosis due to serovar Hardjo were presence of >43 cattle (OR=3.622; IC=1.512-8,677)/animal purchase (OR=3.143; IC=1.557-6.342)/rent of pastures (OR=4.070; IC=1.370-12.087) and presence of horses (OR=2.981; IC=1.321-6.726). These results indicate that Leptospira spp. infection is widespread in the south central region of Paraná state and that factors related to the herd characteristic and management are associated with the infection.
Resumo:
There are few studies that approach the epidemiology of deaths in racehorses in a broad manner. The majority focus on a specific affection or procedure. Brazil does not have a program instituted for the monitoring of deaths of horses. By means of a descriptive study in association with a multivariate analysis method, an epidemiologic profile was determined for deaths related to musculoskeletal (MS), gastrointestinal (GI), respiratory (RES) systems, neurologic origin (NEU) and sudden death (SD) for the years of 2002 to 2008, at the Octavio Dupont Veterinary Hospital-Rio de Janeiro (ODVH). Males comprised the majority of deaths and that deaths were related to, decreasing order, MS>GI>SD>NEU>RES, with respect to general mortality rate per large group of determined causes (TSPMr). The majority of deaths registered included horses aged four to five years (ID4-ID5). We observed the following correspondence relations: (3-year period = SM - ID>5 - SD; ID>5 - GI; ID4-5 - MS; SF - ID<4 - RES/ NEU); (4-year period = SM - ID>5 - GI; SF - ID<4 - NEU; ID4-5 - MS; GI - ID>5). The present study points out the importance and necessity of epidemiologic studies of lesions in horses, based on diagnosis for the recognition of predisposing factors and prevention.
Resumo:
Pythium insidiosum is an oomycete belonging to the kingdom Stramenipila and it is the etiologic agent of pythiosis. Pythiosis is a life-threatening infectious disease characterized by the development of chronic lesions on cutaneous and subcutaneous, intestinal, and bone tissues in humans and many species of animals. The identification of P. insidiosum is important in order to implement a rapid and definitive diagnosis and an effective treatment. This study reports the identification of 54 isolates of P. insidiosum of horses, dogs and sheep that presented suspicious clinical lesions of pythiosis from different regions in Brazil, by using morphological and molecular assays. Throughout the PCR it was possible to confirm the identity of all Brazilian isolates as being P. insidiosum.