Gestation and breastfeeding in schistosomotic mothers differently modulate the immune response of adult offspring to postnatal Schistosoma mansoni infection

Schistosoma mansoni antigens in the early life alter homologous and heterologous immunity during postnatal infections. We evaluate the immunity to parasite antigens and ovalbumin (OA) in adult mice born/suckled by schistosomotic mothers. Newborns were divided into: born (BIM), suckled (SIM) or born/suckled (BSIM) in schistosomotic mothers, and animals from noninfected mothers (control). When adults, the mice were infected and compared the hepatic granuloma size and cellularity. Some animals were OA + adjuvant immunised. We evaluated hypersensitivity reactions (HR), antibodies levels (IgG1/IgG2a) anti-soluble egg antigen and anti-soluble worm antigen preparation, and anti-OA, cytokine production, and CD4+FoxP3+T-cells by splenocytes. Compared to control group, BIM mice showed a greater quantity of granulomas and collagen deposition, whereas SIM and BSIM presented smaller granulomas. BSIM group exhibited the lowest levels of anti-parasite antibodies. For anti-OA immunity, immediate HR was suppressed in all groups, with greater intensity in SIM mice accompanied of the remarkable level of basal CD4+FoxP3+T-cells. BIM and SIM groups produced less interleukin (IL)-4 and interferon (IFN)-g. In BSIM, there was higher production of IL-10 and IFN-g, but lower levels of IL-4 and CD4+FoxP3+T-cells. Thus, pregnancy in schistosomotic mothers intensified hepatic fibrosis, whereas breastfeeding diminished granulomas in descendants. Separately, pregnancy and breastfeeding could suppress heterologous immunity; however, when combined, the responses could be partially restored in infected descendants.

The mc2-CMX vaccine induces an enhanced immune response against Mycobacterium tuberculosis compared to Bacillus Calmette-Guérin but with similar lung inflammatory effects

Although the attenuated Mycobacterium bovis Bacillus Calmette-Guérin (BCG) vaccine has been used since 1921, tuberculosis (TB) control still proceeds at a slow pace. The main reason is the variable efficacy of BCG protection against TB among adults, which ranges from 0-80%. Subsequently, the mc2-CMX vaccine was developed with promising results. Nonetheless, this recombinant vaccine needs to be compared to the standard BCG vaccine. The objective of this study was to evaluate the immune response induced by mc2-CMX and compare it to the response generated by BCG. BALB/c mice were immunised with both vaccines and challenged withMycobacterium tuberculosis (Mtb). The immune and inflammatory responses were evaluated by ELISA, flow cytometry, and histopathology. Mice vaccinated with mc2-CMX and challenged with Mtb induced an increase in the IgG1 and IgG2 levels against CMX as well as recalled specific CD4+ T-cells that produced T-helper 1 cytokines in the lungs and spleen compared with BCG vaccinated and challenged mice. Both vaccines reduced the lung inflammatory pathology induced by the Mtb infection. The mc2-CMX vaccine induces a humoral and cellular response that is superior to BCG and is efficiently recalled after challenge with Mtb, although both vaccines induced similar inflammatory reductions.

Induction of immune response in broiler chickens immunized with recombinant FliC and challenged by Salmonella Typhimurium

The study examined (1) the immune response in broiler chickens after oral immunization with recombinant flagellin (rFliC) from Salmonella Typhimurium conjugated with sodium alginate microparticles, and the immune response enhancement in association with recombinant cholera toxin B subunit protein (rCTB) and pool of Lactobacillus spp. (PL). The immune responses were evaluated by dosage of IgY serum and IgA from intestinal fluid and immunostaining of CD8+ T lymphocytes in the cecum. The immunized animals were challenged with Salmonella Typhimurium (ST) 21 days after treatment. In all immunized groups, a significant increase (p<0.05) was observed in IgA levels (μg/mL), especially three weeks after immunization. The serum IgY levels (μg/mL) were little affected by the treatments and differed significantly among groups only in the second post-immunization week (p<0.05). After the challenge, the number of CD8+ T cells differed significantly between the treatments and negative control. Retrieval of Salmonella Typhimurium was not detected at 48 hours after the challenge in T2 (rFliC+rCTb), T3 (rFliC+PL) and T4 (rFliC+rCTB PL). The rFliC administered orally with or without rCTB and Lactobacillus spp. produces significant induction of humoral immune response, and the immunized chickens were more effective in eliminating Salmonella after challenge.

Cellular immune response of Curraleiro Pé-duro and Nellore calves following Mycobacterium bovis-BCG vaccination

The present study aimed to assess the CD4, CD8 and γδ blood levels for Curraleiro Pé-duro, as well as the specific IFN-γ response after BCG vaccination using flow cytometry. The specific immune response against BCG was also evaluated by tuberculin skin test, performed before and 45 days after the vaccination. For comparison purposes, the same parameters were investigated on Nellore calves, an exotic bovine with resistance previously demonstrated. Naturally, Curraleiro Pé-duro animals had greater levels of CD4, CD8 and γδ lymphocytes (p<0.05). In response to vaccine, Curraleiro Pé-duro showed greater ability to respond specifically to BCG, generating resistance profile (Th1), evidenced by greater number of antigen specific CD4+ cells producing IFN-γ (p<0.05) and also higher tuberculin skin test reaction (p<0.05). Additionally, vaccinated Curraleiro Pé-duro calves had higher CD4 cells numbers than both Nellore control (p<0.05) and vaccinated groups (p<0.05). Curraleiro Pé-duro calves' higher basal lymphocytes blood level and stronger response in both IFN-γ and tuberculin skin test parameters probably play a positive role on protection/resistance to Mycobacterium bovis.

Distribution of immune response cells in the pelvic urethra and the prepuce of rams

The pathogens of the reproductive system in the male can penetrate and establish by ascending route, from to the prepuce to the urethra, accessory glands, epididymis and testicles. The aim of this paper is determine the distribution and number of cells involved in the immune response in prepuce and pelvic urethra of rams, without apparent clinical alterations in testicle, epididymis and prepuce. The distribution of some of the cells involved in the immune response at the level of the prepuce and the pelvic urethra was quantified in four one-year-old rams seronegative for B. ovis and A. seminis and without apparent lesions in the testicles, the epididymis, and the prepuce. At the moment of slaughter, samples were taken from the preputial fornix and the pelvic urethra and placed in 10% formalin and under freezing conditions. CD4, CD8, WC1, CD45RO, CD14 and CD1b cells were demonstrated by immunohistochemistry, and immunoglobulin-containing cells (ICC) of the IgA, IgG and IgM classes were demonstrated by immunofluorescence. The labeled cells present in the mucosa of both organs were counted with an image analyzer. The total number of cells was compared between both tissues and differentially between the epithelium and the connective tissue of the mucosa. Significant differences were found in the total number of CD4, CD45RO, and WC1 lymphocytes, in CD14 macrophages, and CD1b dendritic cells, with mean values being greater in the fornix than in the urethra (p<0.05) in all cases. Only dendritic cells were found in the prepuce. No differences were found in the number of CD8 lymphocytes between both organs. The ratio between each cell type in the connective and the intraepithelial tissues and between organs was 10/1 for CD4 in the fornix (p<0.05), against 7/1 in the urethra (p<0.05), while CD8 had a 1/1 distribution in both mucosae. The WC1 ratio was 5/1 in both mucosae (p<0.05). CD45RO labeling was 19/1 in the prepuce (p<0.05) and 1/1 in the urethra. IgA-containing cells did not show differences in the total number of cells in both tissues. In the urethra, no IgG-containing cells were observed and IgM-containing cells were scarce; in contrast, both cell types were present in the prepuce, in amounts greater than in the urethra (p<0.05). IgA-, IgG-, and IgM-containing cells were located in both organs in the mucosal connective tissue. The presence of antigen-presenting cells, macrophages, and dendritic cells, as well as of lymphocytes CD4, CD8 TCR γδ (WC1), IgA-, IgG and IgM positive cells, and CD45RO cells suggests that both mucosae may behave as inductive and effector sites for the mucosal immune response.

Interleukin-15 as a potential regulator of the innate immune response

Interleukin-15 (IL-15) is a newly-discovered cytokine that is produced by activated monocytes early in the course of the innate immune response. IL-15 is able to bind to components of the interleukin-2 receptor (IL-2R) despite the fact that it has no sequence homology with IL-2. IL-15 stimulates human natural killer cell proliferation, cytotoxicity, and cytokine production and can substitute for IL-2 under most conditions. In vitro studies indicate that monocyte-derived IL-15 may be an important determinant of IFN-gamma production by NK cells. In addition, IL-15 is able to promote the survival of natural killer cells under serum-free conditions. The IL-15 receptor is a heterotrimeric complex which is composed of the IL-2Rß and g chains in combination with a unique alpha chain (IL-15a). The IL-15Ra chain has strong sequence homology to the IL-2Ra chain and confers high affinity binding to the IL-15R. In contrast to IL-2, transcript for IL-15 and IL-15a is expressed in a number of tissues and indicates that IL-15 may be an important ligand for cells that express components of the IL-2R

Characterization of the mucosal and systemic immune response induced by Cry1Ac protein from Bacillus thuringiensis HD 73 in mice

The present paper describes important features of the immune response induced by the Cry1Ac protein from Bacillus thuringiensis in mice. The kinetics of induction of serum and mucosal antibodies showed an immediate production of anti-Cry1Ac IgM and IgG antibodies in serum after the first immunization with the protoxin by either the intraperitoneal or intragastric route. The antibody fraction in serum and intestinal fluids consisted mainly of IgG1. In addition, plasma cells producing anti-Cry1Ac IgG antibodies in Peyer's patches were observed using the solid-phase enzyme-linked immunospot (ELISPOT). Cry1Ac toxin administration induced a strong immune response in serum but in the small intestinal fluids only anti-Cry1Ac IgA antibodies were detected. The data obtained in the present study confirm that the Cry1Ac protoxin is a potent immunogen able to induce a specific immune response in the mucosal tissue, which has not been observed in response to most other proteins.

Immune response induced in mice oral immunization with cowpea severe mosaic virus

There is increasing interest in the immune response induced by plant viruses since these could be used as antigen-expressing systems in vaccination procedures. Cowpea severe mosaic virus (CPSMV), as a purified preparation (300 g of leaves, 2 weeks post-inoculation), or crude extract from cowpea (Vigna unguiculata) leaves infected with CPSMV both administered by gavage to Swiss mice induced a humoral immune response. Groups of 10 Swiss mice (2-month-old females) were immunized orally with 10 daily doses of either 50 µg viral capsid protein (boosters of 50 µg at days 21 and 35 after immunization) or 0.6 mg protein of the crude extract (boosters of 0.6 mg at days 21 and 35 after immunization). Anti-CPSMV antibodies were quantified by ELISA in pooled sera diluted at least 1:400 at days 7, 14, 21, 28, 35 and 42 after the 10th dose. IgG and IgA against CPSMV were produced systemically, but IgE was not detected. No synthesis of specific antibodies against the proteins of leaf extracts from V. unguiculata, infected or not with CPSMV, was detected. The use of CPSMV, a plant-infecting virus that apparently does not induce a pathogenic response in animals, induced a humoral and persistent (at least 6 months) immune response through the administration of low antigen doses by gavage. These results raise the possibility of using CPSMV either as a vector for the production of vaccines against animal pathogens or in quick and easy methods to produce specific antisera for viral diagnosis.

Immune response to respiratory syncytial virus in young Brazilian children

We have evaluated the cellular and humoral immune response to primary respiratory syncytial virus (RSV) infection in young infants. Serum specimens from 65 patients <=12 months of age (39 males and 26 females, 28 cases <3 months and 37 cases > or = 3 months; median 3 ± 3.9 months) were tested for anti-RSV IgG and IgG subclass antibodies by EIA. Flow cytometry was used to characterize cell surface markers expressed on peripheral blood mononuclear cells (PBMC) from 29 RSV-infected children. There was a low rate of seroconversion in children <3 months of age, whose acute-phase PBMC were mostly T lymphocytes (63.0 ± 9.0%). In contrast, a higher rate of seroconversion was observed in children >3 months of age, with predominance of B lymphocytes (71.0 ± 17.7%). Stimulation of PBMC with RSV (2 x 10(5) TCID50) for 48 h did not induce a detectable increase in intracellular cytokines and only a few showed a detectable increase in RSV-specific secreted cytokines. These data suggest that age is an important factor affecting the infants' ability to develop an immune response to RSV.

Effect of surgical treatment on the cellular immune response of gastric cancer patients

Patients with gastric cancer have a variety of immunological abnormalities. In the present study the lymphocytes and their subsets were determined in the peripheral blood of patients with gastric cancer (N = 41) both before and after surgical treatment. The percent of helper/inducer CD4 T cells (43.6 ± 8.9) was not different after tumor resection (43.6 ± 8.2). The percent of the cytotoxic CD8+ T cell population decreased significantly, whether patients were treated surgically (27.2 ± 5.8%, N = 20) or not (27.3 ± 7.3%, N = 20) compared to individuals with inflammatory disease (30.9 ± 7.5%) or to healthy individuals (33.2 ± 7.6%). The CD4/CD8 ratio consequently increased in the group of cancer patients. The peripheral blood lymphocytes of gastric cancer patients showed reduced responsiveness to mitogens. The defective blastogenic response of the lymphocytes was not associated with the production of transforming growth factor beta (TGF-ß) since the patients with cancer had reduced production of TGF-ß1 (269 ± 239 pg/ml, N = 20) in comparison to the normal individuals (884 ± 175 pg/ml, N = 20). These results indicate that the immune response of gastric cancer patients was not significantly modified by surgical treatment when evaluated four weeks after surgery and that the immunosuppression observed was not due to an increase in TGF-ß1 production by peripheral leukocytes.

Impairment of cytomegalovirus-specific cellular immune response as a risk factor for cytomegalovirus disease in transplant recipients

Human cytomegalovirus (CMV) infection is common in most people but nearly asymptomatic in immunocompetent individuals. After primary infection the virus persists throughout life in a latent form in a variety of tissues, particularly in precursor cells of the monocytic lineage. CMV reinfection and occurrence of disease are associated with immunosuppressive conditions. Solid organ and bone marrow transplant patients are at high risk for CMV disease as they undergo immunosuppression. Antiviral treatment is effective in controlling viremia, but 10-15% of infected patients can experience CMV disease by the time the drug is withdrawn. In addition, long-term antiviral treatment leads to bone marrow ablation and renal toxicity. Furthermore, control of chronic CMV infection in transplant recipients appears to be dependent on the proper recovery of cellular immunity. Recent advances in the characterization of T-cell functions and identification of distinct functional signatures of T-cell viral responses have opened new perspectives for monitoring transplant individuals at risk of developing CMV disease.

Recombinant E2 glycoprotein of bovine viral diarrhea virus induces a solid humoral neutralizing immune response but fails to confer total protection in cattle

Two recombinant baculoviruses were produced in order to obtain a bovine viral diarrhea virus (BVDV) immunogen: AcNPV/E2 expressing E2 glycoprotein, and AcNPV/E0E1E2 expressing the polyprotein region coding for the three structural proteins of BVDV (E0, E1, and E2). Mice were immunized with Sf9 cells infected with the recombinant baculoviruses in a water in oil formulation and the production of neutralizing antibodies was evaluated. Since E2 elicited higher neutralizing antibody titers than E0-E1-E2 polyprotein, it was selected to immunize cattle. Calves received two doses of recombinant E2 vaccine and were challenged with homologous BVDV 37 days later. The recombinant immunogen induced neutralizing titers which showed a mean value of 1.5 ± 0.27 on the day of challenge and reached a top value of 3.36 ± 0.36, 47 days later (84 days post-vaccination). On the other hand, sera from animals which received mock-infected Sf9 cells did not show neutralizing activity until 25 days post-challenge (62 days post-vaccination), suggesting that these antibodies were produced as a consequence of BVDV challenge. Even when no total protection was observed in cattle, in vitro viral neutralization assays revealed that the recombinant immunogen was able to induce neutralizing antibody synthesis against the homologous strain as well as against heterologous strains in a very efficient way.

Effect of lipoarabinomannan from Mycobacterium avium subsp avium in Freund’s incomplete adjuvant on the immune response of cattle

The aim of the present study was to determine whether lipoarabinomannan (LAM), in combination with Freund’s incomplete adjuvant (FIA), was able to improve cell-mediated and antibody-mediated immune responses against ovalbumin (OVA) in cattle. Twenty-three calves were assigned to four treatment groups, which were subcutaneously immunized with either OVA plus FIA, OVA plus FIA and LAM from Mycobacterium avium subsp avium, FIA plus LAM, or FIA alone. Lymphoproliferation, IFN-γ production and cell subpopulations on peripheral blood mononuclear cells before and 15 days after treatment were evaluated. Delayed hypersensitivity was evaluated on day 57. Specific humoral immune response was measured by ELISA. Inoculation with LAM induced higher levels of lymphoproliferation and IFN-γ production in response to ConA and OVA (P < 0.05). Specific antibody titers were similar in both OVA-immunized groups. Interestingly, our results showed that the use of LAM in vaccine preparations improved specific cell immune response evaluated by lymphoproliferation and IFN-γ production by at least 50 and 25%, respectively, in cattle without interfering with tuberculosis and paratuberculosis diagnosis.

Association among genetic predisposition, gut microbiota, and host immune response in the etiopathogenesis of inflammatory bowel disease

Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), is a chronic disorder that affects thousands of people around the world. These diseases are characterized by exacerbated uncontrolled intestinal inflammation that leads to poor quality of life in affected patients. Although the exact cause of IBD still remains unknown, compelling evidence suggests that the interplay among immune deregulation, environmental factors, and genetic polymorphisms contributes to the multifactorial nature of the disease. Therefore, in this review we present classical and novel findings regarding IBD etiopathogenesis. Considering the genetic causes of the diseases, alterations in about 100 genes or allelic variants, most of them in components of the immune system, have been related to IBD susceptibility. Dysbiosis of the intestinal microbiota also plays a role in the initiation or perpetuation of gut inflammation, which develops under altered or impaired immune responses. In this context, unbalanced innate and especially adaptive immunity has been considered one of the major contributing factors to IBD development, with the involvement of the Th1, Th2, and Th17 effector population in addition to impaired regulatory responses in CD or UC. Finally, an understanding of the interplay among pathogenic triggers of IBD will improve knowledge about the immunological mechanisms of gut inflammation, thus providing novel tools for IBD control.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.