49 resultados para function and evolution
Resumo:
HTLV-1 Tax expression exerts an inhibitory effect on the Foxp3 transcription factor in CD4+CD25+ T-regulatory cells (Treg). For a better understanding of the role of Tax mRNA in the gene expression of cellular markers we measured Tax, Foxp3, CTLA-4, GITR, TGF-β, and IL-10 mRNA in Treg cells of 50 patients with human T-lymphotropic virus type 1 (HTLV-1)-associated myelopathy/tropical spastic paraparesis (HAM/TSP; 27 women and 23 men; mean age: 56.7 years). The control group consisted of 23 non-infected subjects (12 women and 11 men) with a mean age of 51.3 years. Real-time PCR was used to measure mRNA of Tax proteins and several cellular markers of Treg function. Determinations revealed a high level of Tax mRNA in HAM/TSP (124.35 copies/100 CD4+CD25+ T cells). Foxp3, GITR, and CTLA-4 mRNA levels were lower in HAM/TSP patients (mean ± SD, 22.07 ± 0.78, 9.63 ± 0.36, and 4.54 ± 0.39, respectively) than in non-infected controls (47.15 ± 12.94, 22.14 ± 1.91, and 21.07 ± 2.31). Both groups had similar levels of TGF-β and IL-10. An inverse relationship was found between Tax levels and Foxp3, CTLA-4, and GITR levels. Conversely, there was a direct correlation between levels of Foxp3, GITR, and CTLA-4. Disease severity and evolution time did not correlate with Tax or Foxp3 levels. The present results suggest that Tax and Foxp3 mRNA vary with the same degree of disease severity in HAM/TSP patients. Tax fluctuations may affect CTLA-4 and GITR expression via the Foxp3 pathway, causing virus-induced dysfunction of CD4+CD25+ T cells in HAM/TSP patients.
Resumo:
Heart failure is a common endpoint for many forms of cardiovascular disease and a significant cause of morbidity and mortality. Chronic neurohumoral excitation (i.e., sympathetic hyperactivity) has been considered to be a hallmark of heart failure and is associated with a poor prognosis, cardiac dysfunction and remodeling, and skeletal myopathy. Aerobic exercise training is efficient in counteracting sympathetic hyperactivity and its toxic effects on cardiac and skeletal muscles. In this review, we describe the effects of aerobic exercise training on sympathetic hyperactivity, skeletal myopathy, as well as cardiac function and remodeling in human and animal heart failure. We also discuss the mechanisms underlying the effects of aerobic exercise training.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
Introduction: Pre-implantation kidney biopsy is a decision-making tool when considering the use of grafts from deceased donors with expanded criteria, implanting one or two kidneys and comparing this to post-transplantation biopsies. The role of histopathological alterations in kidney compartments as a prognostic factor in graft survival and function has had conflicting results. Objective: This study evaluated the prevalence of chronic alterations in pre-implant biopsies of kidney grafts and the association of findings with graft function and survival in one year post-transplant. Methods: 110 biopsies were analyzed between 2006 and 2009 at Santa Casa de Porto Alegre, including live donors, ideal deceased donors and those with expanded criteria. The score was computed according to criteria suggested by Remuzzi. The glomerular filtration rate (GFR) was calculated using the abbreviated MDRD formula. Results: No statistical difference was found in the survival of donors stratified according to Remuzzi criteria. The GFR was significantly associated with the total scores in the groups with mild and moderate alterations, and in the kidney compartments alone, by univariate analysis. The multivariate model found an association with the presence of arteriosclerosis, glomerulosclerosis, acute rejection and delayed graft function. Conclusion: Pre-transplant chronic kidney alterations did not influence the post-transplantation one-year graft survival, but arteriosclerosis and glomerulosclerosis is predictive of a worse GFR. Delayed graft function and acute rejection are independent prognostic factors.